Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

KLF4 cdna clone

KLF4 cDNA Clone

Gene Names
KLF4; EZF; GKLF
Synonyms
KLF4; KLF4 cDNA Clone; KLF4 cdna clone
Ordering
For Research Use Only!
Sequence
atggctgtcagcgacgcgctgctcccatctttctccacgttcgcgtctggcccggcgggaagggagaagacactgcgtcaagcaggtgccccgaataaccgctggcgggaggagctctcccacatgaagcgacttcccccagtgcttcccggccgcccctatgacctggcggcggcgaccgtggccacagacctggagagcggcggagccggtgcggcttgcggcggtagcaacctggcgcccctacctcggagagagaccgaggagttcaacgatctcctggacctggactttattctctccaattcgctgacccatcctccggagtcagtggccgccaccgtgtcctcgtcagcgtcagcctcctcttcgtcgtcgccgtcgagcagcggccctgccagcgcgccctccacctgcagcttcacctatccgatccgggccgggaacgacccgggcgtggcgccgggcggcacgggcggaggcctcctctatggcagggagtccgctccccctccgacggctcccttcaacctggcggacatcaacgacgtgagcccctcgggcggcttcgtggccgagctcctgcggccagaattggacccggtgtacattccgccgcagcagccgcagccgccaggtggcgggctgatgggcaagttcgtgctgaaggcgtcgctgagcgcccctggcagcgagtacggcagcccgtcggtcatcagcgtcagcaaaggcagccctgacggcagccacccggtggtggtggcgccctacaacggcgggccgccgcgcacgtgccccaagatcaagcaggaggcggtctcttcgtgcacccacttgggcgctggaccccctctcagcaatggccaccggccggctgcacacgacttccccctggggcggcagctccccagcaggactaccccgaccctgggtcttgaggaagtgctgagcagcagggactgtcaccctgccctgccgcttcctcccggcttccatccccacccggggcccaattacccatccttcctgcccgatcagatgcagccgcaagtcccgccgctccattaccaagagctcatgccacccggttcctgcatgccagaggagcccaagccaaagaggggaagacgatcgtggccccggaaaaggaccgccacccacacttgtgattacgcgggctgcggcaaaacctacacaaagagttcccatctcaaggcacacctgcgaacccacacaggtgagaaaccttaccactgtgactgggacggctgtggatggaaattcgcccgctcagatgaactgaccaggcactaccgtaaacacacggggcaccgcccgttccagtgccaaaaatgcgaccgagcattttccaggtcggaccacctcgccttacacatgaagaggcatttttaa
Sequence Length
1413
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
6,489 Da
NCBI Official Full Name
Homo sapiens Kruppel-like factor 4 (gut), mRNA
NCBI Official Synonym Full Names
Kruppel like factor 4
NCBI Official Symbol
KLF4
NCBI Official Synonym Symbols
EZF; GKLF
NCBI Protein Information
Krueppel-like factor 4
UniProt Protein Name
Krueppel-like factor 4
Protein Family
UniProt Gene Name
KLF4
UniProt Synonym Gene Names
EZF; GKLF
UniProt Entry Name
KLF4_HUMAN

NCBI Description

This gene encodes a protein that belongs to the Kruppel family of transcription factors. The encoded zinc finger protein is required for normal development of the barrier function of skin. The encoded protein is thought to control the G1-to-S transition of the cell cycle following DNA damage by mediating the tumor suppressor gene p53. Mice lacking this gene have a normal appearance but lose weight rapidly, and die shortly after birth due to fluid evaporation resulting from compromised epidermal barrier function. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]

Uniprot Description

KLF4: Transcription factor; can act both as activator and as repressor. Binds the 5'-CACCC-3' core sequence. Binds to the promoter region of its own gene and can activate its own transcription. Regulates the expression of key transcription factors during embryonic development. Plays an important role in maintaining embryonic stem cells, and in preventing their differentiation. Required for establishing the barrier function of the skin and for postnatal maturation and maintenance of the ocular surface. Involved in the differentiation of epithelial cells and may also function in skeletal and kidney development. Contributes to the down-regulation of p53/TP53 transcription. Interacts with POU5F1/OCT4 and SOX2. Interacts with MUC1 (via the C-terminal domain). Belongs to the krueppel C2H2-type zinc-finger protein family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: C2H2-type zinc finger protein; Transcription factor; DNA-binding

Chromosomal Location of Human Ortholog: 9q31

Cellular Component: nuclear chromatin; nucleoplasm

Molecular Function: protein binding

Biological Process: fat cell differentiation; inhibition of NF-kappaB transcription factor; mesodermal cell fate determination; negative regulation of caspase activity; negative regulation of cell proliferation; negative regulation of heterotypic cell-cell adhesion; negative regulation of inflammatory response; negative regulation of interleukin-8 biosynthetic process; negative regulation of transcription from RNA polymerase II promoter; negative regulation of transcription, DNA-dependent; positive regulation of cellular protein metabolic process; positive regulation of hemoglobin biosynthetic process; positive regulation of nitric oxide biosynthetic process; positive regulation of protein metabolic process; positive regulation of telomerase activity; positive regulation of transcription from RNA polymerase II promoter; positive regulation of transcription, DNA-dependent; post-embryonic hemopoiesis; regulation of cell differentiation; somatic stem cell maintenance; stem cell maintenance; transcription from RNA polymerase II promoter

Research Articles on KLF4

Similar Products

Product Notes

The KLF4 klf4 (Catalog #AAA1267446) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctgtca gcgacgcgct gctcccatct ttctccacgt tcgcgtctgg cccggcggga agggagaaga cactgcgtca agcaggtgcc ccgaataacc gctggcggga ggagctctcc cacatgaagc gacttccccc agtgcttccc ggccgcccct atgacctggc ggcggcgacc gtggccacag acctggagag cggcggagcc ggtgcggctt gcggcggtag caacctggcg cccctacctc ggagagagac cgaggagttc aacgatctcc tggacctgga ctttattctc tccaattcgc tgacccatcc tccggagtca gtggccgcca ccgtgtcctc gtcagcgtca gcctcctctt cgtcgtcgcc gtcgagcagc ggccctgcca gcgcgccctc cacctgcagc ttcacctatc cgatccgggc cgggaacgac ccgggcgtgg cgccgggcgg cacgggcgga ggcctcctct atggcaggga gtccgctccc cctccgacgg ctcccttcaa cctggcggac atcaacgacg tgagcccctc gggcggcttc gtggccgagc tcctgcggcc agaattggac ccggtgtaca ttccgccgca gcagccgcag ccgccaggtg gcgggctgat gggcaagttc gtgctgaagg cgtcgctgag cgcccctggc agcgagtacg gcagcccgtc ggtcatcagc gtcagcaaag gcagccctga cggcagccac ccggtggtgg tggcgcccta caacggcggg ccgccgcgca cgtgccccaa gatcaagcag gaggcggtct cttcgtgcac ccacttgggc gctggacccc ctctcagcaa tggccaccgg ccggctgcac acgacttccc cctggggcgg cagctcccca gcaggactac cccgaccctg ggtcttgagg aagtgctgag cagcagggac tgtcaccctg ccctgccgct tcctcccggc ttccatcccc acccggggcc caattaccca tccttcctgc ccgatcagat gcagccgcaa gtcccgccgc tccattacca agagctcatg ccacccggtt cctgcatgcc agaggagccc aagccaaaga ggggaagacg atcgtggccc cggaaaagga ccgccaccca cacttgtgat tacgcgggct gcggcaaaac ctacacaaag agttcccatc tcaaggcaca cctgcgaacc cacacaggtg agaaacctta ccactgtgac tgggacggct gtggatggaa attcgcccgc tcagatgaac tgaccaggca ctaccgtaaa cacacggggc accgcccgtt ccagtgccaa aaatgcgacc gagcattttc caggtcggac cacctcgcct tacacatgaa gaggcatttt taa. It is sometimes possible for the material contained within the vial of "KLF4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.