Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

KLF10 cdna clone

KLF10 cDNA Clone

Gene Names
KLF10; EGRA; TIEG; TIEG1; EGR-alpha
Synonyms
KLF10; KLF10 cDNA Clone; KLF10 cdna clone
Ordering
For Research Use Only!
Sequence
atggaggaaagaatggaaatgatttctgaaaggccaaaagagagtatgtattcctggaacaaaactgcagagaaaagtgattttgaagctgtagaagcacttatgtcaatgagctgcagttggaagtctgattttaagaaatacgttgaaaacagacctgttacaccagtatctgatttgtcagaggaagagaatctgcttccgggaacacctgattttcatacaatcccagcattttgtttgactccaccttacagtccttctgactttgaaccctctcaagtgtcaaatctgatggcaccagcgccatctactgtacacttcaagtcactctcagatactgccaaacctcacattgccgcacctttcaaagaggaagaaaagagcccagtatctgcccccaaactccccaaagctcaggcaacaagtgtgattcgtcatacagctgatgcccagctatgtaaccaccagacctgcccaatgaaagcagccagcatcctcaactatcagaacaattcttttagaagaagaacccacctaaatgttgaggctgcaagaaagaacataccatgtgccgctgtgtcaccaaacagatccaaatgtgagagaaacacagtggcagatgttgatgagaaagcaagtgctgcactttatgacttttctgtgccttcctcagagacggtcatctgcaggtctcagccagcccctgtgtccccacaacagaagtcagtgttggtctctccacctgcagtatctgcagggggagtgccacctatgccggtcatctgccagatggttccccttcctgccaacaaccctgttgtgacaacagtcgttcccagcactcctcccagccagccaccagccgtttgcccccctgttgtgttcatgggcacacaagtccccaaaggcgctgtcatgtttgtggtaccccagcccgttgtgcagagttcaaagcctccggtggtgagcccgaatggcaccagactctctcccattgcccctgctcctgggttttccccttcagcagcaaaagtcactcctcagattgattcatcaaggataaggagtcacatctgtagccacccaggatgtggcaagacatactttaaaagttcccatctgaaggcccacacgaggacgcacacaggagaaaagcctttcagctgtagctggaaaggttgtgaaaggaggtttgcccgttctgatgaactgtccagacacaggcgaacccacacgggtgagaagaaatttgcgtgccccatgtgtgaccggcggttcatgaggagtgaccatttgaccaagcatgcccggcgccatctatcagccaagaagctaccaaactggcagatggaagtgagcaagctaaatgacattgctctacctccaacccctgctcccacacagtga
Sequence Length
1410
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
13,702 Da
NCBI Official Full Name
Homo sapiens Kruppel-like factor 10, mRNA
NCBI Official Synonym Full Names
Kruppel like factor 10
NCBI Official Symbol
KLF10
NCBI Official Synonym Symbols
EGRA; TIEG; TIEG1; EGR-alpha
NCBI Protein Information
Krueppel-like factor 10
UniProt Protein Name
Krueppel-like factor 10
Protein Family
UniProt Gene Name
KLF10
UniProt Synonym Gene Names
TIEG; TIEG1; TGFB-inducible early growth response protein 1; TIEG-1
UniProt Entry Name
KLF10_HUMAN

NCBI Description

This gene encodes a member of a family of proteins that feature C2H2-type zinc finger domains. The encoded protein is a transcriptional repressor that acts as an effector of transforming growth factor beta signaling. Activity of this protein may inhibit the growth of cancers, particularly pancreatic cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013]

Uniprot Description

KLF10: Transcriptional repressor involved in the regulation of cell growth. Inhibits cell growth. Binds to the consensus sequence 5'-GGTGTG-3'. Belongs to the Sp1 C2H2-type zinc-finger protein family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: C2H2-type zinc finger protein; DNA-binding; Transcription factor

Chromosomal Location of Human Ortholog: 8q22.2

Cellular Component: nucleus

Molecular Function: protein binding; transcription factor activity

Biological Process: cell proliferation; cell-cell signaling; cellular response to starvation; negative regulation of cell proliferation; negative regulation of transcription from RNA polymerase II promoter; negative regulation of transcription, DNA-dependent; regulation of circadian rhythm; skeletal development; transforming growth factor beta receptor signaling pathway

Research Articles on KLF10

Similar Products

Product Notes

The KLF10 klf10 (Catalog #AAA1274316) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaggaaa gaatggaaat gatttctgaa aggccaaaag agagtatgta ttcctggaac aaaactgcag agaaaagtga ttttgaagct gtagaagcac ttatgtcaat gagctgcagt tggaagtctg attttaagaa atacgttgaa aacagacctg ttacaccagt atctgatttg tcagaggaag agaatctgct tccgggaaca cctgattttc atacaatccc agcattttgt ttgactccac cttacagtcc ttctgacttt gaaccctctc aagtgtcaaa tctgatggca ccagcgccat ctactgtaca cttcaagtca ctctcagata ctgccaaacc tcacattgcc gcacctttca aagaggaaga aaagagccca gtatctgccc ccaaactccc caaagctcag gcaacaagtg tgattcgtca tacagctgat gcccagctat gtaaccacca gacctgccca atgaaagcag ccagcatcct caactatcag aacaattctt ttagaagaag aacccaccta aatgttgagg ctgcaagaaa gaacatacca tgtgccgctg tgtcaccaaa cagatccaaa tgtgagagaa acacagtggc agatgttgat gagaaagcaa gtgctgcact ttatgacttt tctgtgcctt cctcagagac ggtcatctgc aggtctcagc cagcccctgt gtccccacaa cagaagtcag tgttggtctc tccacctgca gtatctgcag ggggagtgcc acctatgccg gtcatctgcc agatggttcc ccttcctgcc aacaaccctg ttgtgacaac agtcgttccc agcactcctc ccagccagcc accagccgtt tgcccccctg ttgtgttcat gggcacacaa gtccccaaag gcgctgtcat gtttgtggta ccccagcccg ttgtgcagag ttcaaagcct ccggtggtga gcccgaatgg caccagactc tctcccattg cccctgctcc tgggttttcc ccttcagcag caaaagtcac tcctcagatt gattcatcaa ggataaggag tcacatctgt agccacccag gatgtggcaa gacatacttt aaaagttccc atctgaaggc ccacacgagg acgcacacag gagaaaagcc tttcagctgt agctggaaag gttgtgaaag gaggtttgcc cgttctgatg aactgtccag acacaggcga acccacacgg gtgagaagaa atttgcgtgc cccatgtgtg accggcggtt catgaggagt gaccatttga ccaagcatgc ccggcgccat ctatcagcca agaagctacc aaactggcag atggaagtga gcaagctaaa tgacattgct ctacctccaa cccctgctcc cacacagtga. It is sometimes possible for the material contained within the vial of "KLF10, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.