Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

KCNQ1DN cdna clone

KCNQ1DN cDNA Clone

Gene Names
KCNQ1DN; BWRT; HSA404617
Synonyms
KCNQ1DN; KCNQ1DN cDNA Clone; KCNQ1DN cdna clone
Ordering
For Research Use Only!
Sequence
ATGGGCAGGAAGTGGTCAGGACCCACTGCCGAGCACCAACTCCCCATGCCACCACCAGGGGTGCGCCTGGACTCCTGGAAAGGGGTCGCGTCAGGGTGCAGCCCATCAAAGGCTTCCCAAGAGGCAAGAGGCAAGGAGAAGTGTCCTACTTTAAACGGCCAGCCTCAGTGGTCGGCCCTGTTCACTCTGCCACCTCAGAGAGAGTGA
Sequence Length
207
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
7,384 Da
NCBI Official Full Name
Homo sapiens KCNQ1 downstream neighbor, mRNA
NCBI Official Synonym Full Names
KCNQ1 downstream neighbor (non-protein coding)
NCBI Official Symbol
KCNQ1DN
NCBI Official Synonym Symbols
BWRT; HSA404617
UniProt Protein Name
KCNQ1 downstream neighbor protein
UniProt Gene Name
KCNQ1DN
UniProt Synonym Gene Names
BWRT
UniProt Entry Name
KCQ1D_HUMAN

NCBI Description

Imprinting is a phenomenon in which epigenetic modifications lead to expression or suppression of alleles of some genes based on their parental origin. Wilms tumor-2 (WT2; MIM 194071) is defined by maternal-specific loss of heterozygosity of a critical region on chromosome 11p15.5 that includes several imprinted genes. KCNQ1DN is an imprinted gene located within the WT2 critical region that is expressed from the maternal allele (Xin et al., 2000 [PubMed 11056398]).[supplied by OMIM, Mar 2008]

Uniprot Description

KCNQ1DN:

Chromosomal Location of Human Ortholog: 11p15.4|11p15.5

Similar Products

Product Notes

The KCNQ1DN kcnq1dn (Catalog #AAA1278693) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGGGCAGGA AGTGGTCAGG ACCCACTGCC GAGCACCAAC TCCCCATGCC ACCACCAGGG GTGCGCCTGG ACTCCTGGAA AGGGGTCGCG TCAGGGTGCA GCCCATCAAA GGCTTCCCAA GAGGCAAGAG GCAAGGAGAA GTGTCCTACT TTAAACGGCC AGCCTCAGTG GTCGGCCCTG TTCACTCTGC CACCTCAGAG AGAGTGA. It is sometimes possible for the material contained within the vial of "KCNQ1DN, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.