Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

KCNN2 cdna clone

KCNN2 cDNA Clone

Gene Names
KCNN2; SK2; hSK2; SKCA2; KCa2.2; SKCa 2
Synonyms
KCNN2; KCNN2 cDNA Clone; KCNN2 cdna clone
Ordering
For Research Use Only!
Sequence
atgtggttgatatcaataacttttctctccattggttatggtgacatggtacctaacacatactgtggaaaaggagtctgcttacttactggaattatgggtgctggttgcacagccctggtggtagctgtagtggcaaggaagctagaacttaccaaagcagaaaaacacgtgcacaatttcatgatggatactcagctgactaaaagagtaaaaaatgcagctgccaatgtactcagggaaacatggctaatttacaaaaatacaaagctagtgaaaaagatagatcatgcaaaagtaagaaaacatcaacgaaaattcctgcaagctattcatcaattaagaagtgtaaaaatggagcagaggaaactgaatgaccaagcaaacactttggtggacttggcaaagacccagaacatcatgtatgatatgatttctgacttaaacgaaaggagtgaagacttcgagaagaggattgttaccctggaaacaaaactagagactttgattggtagcatccacgccctccctgggctcataagccagaccatcaggcagcagcagagagatttcattgaggctcagatggagagctacgacaagcacgtcacttacaatgctgagcggtcccggtcctcgtccaggaggcggcggtcctcttccacagcaccaccaacttcatcagagagtagctag
Sequence Length
696
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
26,341 Da
NCBI Official Full Name
Homo sapiens potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2, mRNA
NCBI Official Synonym Full Names
potassium calcium-activated channel subfamily N member 2
NCBI Official Symbol
KCNN2
NCBI Official Synonym Symbols
SK2; hSK2; SKCA2; KCa2.2; SKCa 2
NCBI Protein Information
small conductance calcium-activated potassium channel protein 2
UniProt Protein Name
Small conductance calcium-activated potassium channel protein 2
UniProt Gene Name
KCNN2
UniProt Synonym Gene Names
SK2; SKCa 2; SKCa2
UniProt Entry Name
KCNN2_HUMAN

NCBI Description

Action potentials in vertebrate neurons are followed by an afterhyperpolarization (AHP) that may persist for several seconds and may have profound consequences for the firing pattern of the neuron. Each component of the AHP is kinetically distinct and is mediated by different calcium-activated potassium channels. The protein encoded by this gene is activated before membrane hyperpolarization and is thought to regulate neuronal excitability by contributing to the slow component of synaptic AHP. This gene is a member of the KCNN family of potassium channel genes. The encoded protein is an integral membrane protein that forms a voltage-independent calcium-activated channel with three other calmodulin-binding subunits. Alternate splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2013]

Uniprot Description

KCNN2: Forms a voltage-independent potassium channel activated by intracellular calcium. Activation is followed by membrane hyperpolarization. Thought to regulate neuronal excitability by contributing to the slow component of synaptic afterhyperpolarization. The channel is blocked by apamin. Belongs to the potassium channel KCNN family. KCa2.2/KCNN2 subfamily.

Protein type: Membrane protein, integral; Channel, potassium; Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: 5q22.3

Cellular Component: cell soma; cell surface; dendritic spine; plasma membrane

Molecular Function: alpha-actinin binding; calcium-activated potassium channel activity; calmodulin binding; protein domain specific binding; protein homodimerization activity; small conductance calcium-activated potassium channel activity

Research Articles on KCNN2

Similar Products

Product Notes

The KCNN2 kcnn2 (Catalog #AAA1270044) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtggttga tatcaataac ttttctctcc attggttatg gtgacatggt acctaacaca tactgtggaa aaggagtctg cttacttact ggaattatgg gtgctggttg cacagccctg gtggtagctg tagtggcaag gaagctagaa cttaccaaag cagaaaaaca cgtgcacaat ttcatgatgg atactcagct gactaaaaga gtaaaaaatg cagctgccaa tgtactcagg gaaacatggc taatttacaa aaatacaaag ctagtgaaaa agatagatca tgcaaaagta agaaaacatc aacgaaaatt cctgcaagct attcatcaat taagaagtgt aaaaatggag cagaggaaac tgaatgacca agcaaacact ttggtggact tggcaaagac ccagaacatc atgtatgata tgatttctga cttaaacgaa aggagtgaag acttcgagaa gaggattgtt accctggaaa caaaactaga gactttgatt ggtagcatcc acgccctccc tgggctcata agccagacca tcaggcagca gcagagagat ttcattgagg ctcagatgga gagctacgac aagcacgtca cttacaatgc tgagcggtcc cggtcctcgt ccaggaggcg gcggtcctct tccacagcac caccaacttc atcagagagt agctag. It is sometimes possible for the material contained within the vial of "KCNN2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.