Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

KCNK17 cdna clone

KCNK17 cDNA Clone

Gene Names
KCNK17; TALK2; TASK4; TALK-2; TASK-4; K2p17.1
Synonyms
KCNK17; KCNK17 cDNA Clone; KCNK17 cdna clone
Ordering
For Research Use Only!
Sequence
atgtaccgaccgcgagcccgggcggctcccgagggcagggtccggggctgcgcggtgcccggcaccgtgctcctgctgctcgcctacctggcttacctggcgctgggcaccggcgtgttctggacgctggagggccgcgcggcgcaggactccagccgcagcttccagcgcgacaagtgggagctgttgcagaacttcacgtgtctggaccgcccggcgctggactcgctgatccgggatgtcgtccaagcatacaaaaacggagccagcctcctcagcaacaccaccagcatggggcgctgggagctcgtgggctccttcttcttttctgtgtccaccatcaccaccattggctatggcaacctgagccccaacacgatggctgcccgcctcttctgcatcttctttgcccttgtggggatcccactcaacctcgtggtgctcaaccgactggggcatctcatgcagcagggagtaaaccactgggccagcaggctggggggcacctggcaggatcctgacaaggcgcggtggctggcgggctctggcgccctcctctcgggcctcctgctcttcctgctgctgccaccgctgctcttctcccacatggagggctggagctacacagagggcttctacttcgccttcatcaccctcagcaccgtgggcttcggcgactacgtgattggaatgaacccctcccagaggtacccactgtggtacaagaacatggtgtccctgtggatcctctttgggatggcatggctggccttgatcatcaaactcatcctctcccagctggagacgccagggagggtatgttcctgctgccaccacagctctaaggaagacttcaagtcccaaagctggagacagggacctgaccgggagccagagtcccactccccacagcaaggatgctatccagagggacccatgggaatcatacagcatctggaaccttctgctcacgctgcaggctgtggcaaggacagctag
Sequence Length
999
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
29,972 Da
NCBI Official Full Name
Homo sapiens potassium channel, subfamily K, member 17, mRNA
NCBI Official Synonym Full Names
potassium two pore domain channel subfamily K member 17
NCBI Official Symbol
KCNK17
NCBI Official Synonym Symbols
TALK2; TASK4; TALK-2; TASK-4; K2p17.1
NCBI Protein Information
potassium channel subfamily K member 17
UniProt Protein Name
Potassium channel subfamily K member 17
UniProt Gene Name
KCNK17
UniProt Synonym Gene Names
TALK2; TASK4; TALK-2
UniProt Entry Name
KCNKH_HUMAN

NCBI Description

The protein encoded by this gene belongs to the family of potassium channel proteins containing two pore-forming P domains. This channel is an open rectifier which primarily passes outward current under physiological K+ concentrations. This gene is activated at alkaline pH. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]

Uniprot Description

KCNK17: Outward rectifying potassium channel. Produces rapidly activating and non-inactivating outward rectifier K(+) currents. Belongs to the two pore domain potassium channel (TC 1.A.1.8) family.

Protein type: Membrane protein, multi-pass; Membrane protein, integral

Chromosomal Location of Human Ortholog: 6p21.1

Cellular Component: integral to plasma membrane; plasma membrane

Molecular Function: potassium channel activity; potassium ion leak channel activity

Biological Process: potassium ion transport; stabilization of membrane potential

Research Articles on KCNK17

Similar Products

Product Notes

The KCNK17 kcnk17 (Catalog #AAA1267859) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtaccgac cgcgagcccg ggcggctccc gagggcaggg tccggggctg cgcggtgccc ggcaccgtgc tcctgctgct cgcctacctg gcttacctgg cgctgggcac cggcgtgttc tggacgctgg agggccgcgc ggcgcaggac tccagccgca gcttccagcg cgacaagtgg gagctgttgc agaacttcac gtgtctggac cgcccggcgc tggactcgct gatccgggat gtcgtccaag catacaaaaa cggagccagc ctcctcagca acaccaccag catggggcgc tgggagctcg tgggctcctt cttcttttct gtgtccacca tcaccaccat tggctatggc aacctgagcc ccaacacgat ggctgcccgc ctcttctgca tcttctttgc ccttgtgggg atcccactca acctcgtggt gctcaaccga ctggggcatc tcatgcagca gggagtaaac cactgggcca gcaggctggg gggcacctgg caggatcctg acaaggcgcg gtggctggcg ggctctggcg ccctcctctc gggcctcctg ctcttcctgc tgctgccacc gctgctcttc tcccacatgg agggctggag ctacacagag ggcttctact tcgccttcat caccctcagc accgtgggct tcggcgacta cgtgattgga atgaacccct cccagaggta cccactgtgg tacaagaaca tggtgtccct gtggatcctc tttgggatgg catggctggc cttgatcatc aaactcatcc tctcccagct ggagacgcca gggagggtat gttcctgctg ccaccacagc tctaaggaag acttcaagtc ccaaagctgg agacagggac ctgaccggga gccagagtcc cactccccac agcaaggatg ctatccagag ggacccatgg gaatcataca gcatctggaa ccttctgctc acgctgcagg ctgtggcaag gacagctag. It is sometimes possible for the material contained within the vial of "KCNK17, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.