Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

KCNJ3 cdna clone

KCNJ3 cDNA Clone

Gene Names
KCNJ3; KGA; GIRK1; KIR3.1
Synonyms
KCNJ3; KCNJ3 cDNA Clone; KCNJ3 cdna clone
Ordering
For Research Use Only!
Sequence
atgtctgcactccgaaggaaatttggggacgattatcaggtagtgaccacatcgtccagcggctcgggcttgcagccccaggggccaggccaggaccctcagcagcagcttgtgcccaagaagaagcggcagcggttcgtggacaagaacggccggtgcaatgtacagcacggcaacctgggcagcgagacaagccgctacctctcggacctcttcaccacgctggtggacctcaagtggcgctggaacctcttcatcttcattctcacctacaccgtggcctggcttttcatggcgtccatgtggtgggtgatcgcctacactcggggcgacctgaacaaagcccacgtcggtaactacacgccttgcgtggccaatgtctataacttcccttctgccttcctcttcttcatcgagacggaggccaccatcggctatggctaccgatacatcacagacaagtgccccgagggcatcatcctcttcctcttccagtccatcctgggctccatcgtggacgccttcctcatcggctgcatgttcatcaagatgtcccagcccaagaagcgcgccgagaccctcatgttcagcgagcacgcggtgatctccatgagggacggaaaactcacgcttatgttccgggtgggcaacctgcgcaacagccacatggtctccgcgcagattcgctgcaagctgctcaaatctcggcagacacctgagggtgagttccttccccttgaccaacttgaactggatgtaggttttagtacaggggcagatcaactttttcttgtgtcccccctcacaattcgccacgtgatcgatgccaaaagccccttttatgacctatcccagcgaagcatgcaaactaaacagttcgagattgtcgtcatcctagaaggcattgtggaaacaactgggatgacttgtcaagctcgaacatcatatactgaagatgaagttctttggggtcatcgtttttttcctgtaatttccttagaagagggattctttaaagttgattactcccagttccacgcaacatttgaagtccccaccccaccttacagtgtgaaagagcaggaggaaatgcttctcatgtcgtcccctttaatagcaccagccataactaacagcaaagaaagacataattctgtggaatgcttagatggactagatgatattactacaaaactaccatctaagctgcagaaaattactggaagagaagactttcccaaaaaactcttgaggatgagttctacaacttcagaaaaagcctacagcttgggagacttgcccatgaaacttcaacgaataagttcagttccgggcaactcagaagaaaaactggtatctaaaaccaccaagatgttatctgatcccatgagccagtctgtggctgatttgccaccaaagcttcaaaagatggctggaggagcagctaggatggaagggaaccttccagccaaattaagaaaaatgaactctgatcgcttcacataa
Sequence Length
1506
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
26,829 Da
NCBI Official Full Name
Homo sapiens potassium inwardly-rectifying channel, subfamily J, member 3, mRNA
NCBI Official Synonym Full Names
potassium voltage-gated channel subfamily J member 3
NCBI Official Symbol
KCNJ3
NCBI Official Synonym Symbols
KGA; GIRK1; KIR3.1
NCBI Protein Information
G protein-activated inward rectifier potassium channel 1
UniProt Protein Name
G protein-activated inward rectifier potassium channel 1
UniProt Gene Name
KCNJ3
UniProt Synonym Gene Names
GIRK1; GIRK-1
UniProt Entry Name
KCNJ3_HUMAN

NCBI Description

Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. The encoded protein, which has a greater tendency to allow potassium to flow into a cell rather than out of a cell, is controlled by G-proteins and plays an important role in regulating heartbeat. It associates with three other G-protein-activated potassium channels to form a heteromultimeric pore-forming complex that also couples to neurotransmitter receptors in the brain and whereby channel activation can inhibit action potential firing by hyperpolarizing the plasma membrane. These multimeric G-protein-gated inwardly-rectifying potassium (GIRK) channels may play a role in the pathophysiology of epilepsy, addiction, Down's syndrome, ataxia, and Parkinson's disease. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, May 2012]

Uniprot Description

GIRK1: This potassium channel is controlled by G proteins. Inward rectifier potassium channels are characterized by a greater tendency to allow potassium to flow into the cell rather than out of it. Their voltage dependence is regulated by the concentration of extracellular potassium; as external potassium is raised, the voltage range of the channel opening shifts to more positive voltages. The inward rectification is mainly due to the blockage of outward current by internal magnesium. This receptor plays a crucial role in regulating the heartbeat. Belongs to the inward rectifier-type potassium channel (TC 1.A.2.1) family. KCNJ3 subfamily.

Protein type: Channel, potassium; Membrane protein, multi-pass; Membrane protein, integral

Chromosomal Location of Human Ortholog: 2q24.1

Cellular Component: plasma membrane; voltage-gated potassium channel complex

Molecular Function: G-protein activated inward rectifier potassium channel activity; inward rectifier potassium channel activity; protein binding

Biological Process: potassium ion import; potassium ion transport

Research Articles on KCNJ3

Similar Products

Product Notes

The KCNJ3 kcnj3 (Catalog #AAA1271497) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctgcac tccgaaggaa atttggggac gattatcagg tagtgaccac atcgtccagc ggctcgggct tgcagcccca ggggccaggc caggaccctc agcagcagct tgtgcccaag aagaagcggc agcggttcgt ggacaagaac ggccggtgca atgtacagca cggcaacctg ggcagcgaga caagccgcta cctctcggac ctcttcacca cgctggtgga cctcaagtgg cgctggaacc tcttcatctt cattctcacc tacaccgtgg cctggctttt catggcgtcc atgtggtggg tgatcgccta cactcggggc gacctgaaca aagcccacgt cggtaactac acgccttgcg tggccaatgt ctataacttc ccttctgcct tcctcttctt catcgagacg gaggccacca tcggctatgg ctaccgatac atcacagaca agtgccccga gggcatcatc ctcttcctct tccagtccat cctgggctcc atcgtggacg ccttcctcat cggctgcatg ttcatcaaga tgtcccagcc caagaagcgc gccgagaccc tcatgttcag cgagcacgcg gtgatctcca tgagggacgg aaaactcacg cttatgttcc gggtgggcaa cctgcgcaac agccacatgg tctccgcgca gattcgctgc aagctgctca aatctcggca gacacctgag ggtgagttcc ttccccttga ccaacttgaa ctggatgtag gttttagtac aggggcagat caactttttc ttgtgtcccc cctcacaatt cgccacgtga tcgatgccaa aagccccttt tatgacctat cccagcgaag catgcaaact aaacagttcg agattgtcgt catcctagaa ggcattgtgg aaacaactgg gatgacttgt caagctcgaa catcatatac tgaagatgaa gttctttggg gtcatcgttt ttttcctgta atttccttag aagagggatt ctttaaagtt gattactccc agttccacgc aacatttgaa gtccccaccc caccttacag tgtgaaagag caggaggaaa tgcttctcat gtcgtcccct ttaatagcac cagccataac taacagcaaa gaaagacata attctgtgga atgcttagat ggactagatg atattactac aaaactacca tctaagctgc agaaaattac tggaagagaa gactttccca aaaaactctt gaggatgagt tctacaactt cagaaaaagc ctacagcttg ggagacttgc ccatgaaact tcaacgaata agttcagttc cgggcaactc agaagaaaaa ctggtatcta aaaccaccaa gatgttatct gatcccatga gccagtctgt ggctgatttg ccaccaaagc ttcaaaagat ggctggagga gcagctagga tggaagggaa ccttccagcc aaattaagaa aaatgaactc tgatcgcttc acataa. It is sometimes possible for the material contained within the vial of "KCNJ3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.