Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

KCNJ13 cdna clone

KCNJ13 cDNA Clone

Gene Names
KCNJ13; SVD; LCA16; KIR1.4; KIR7.1
Synonyms
KCNJ13; KCNJ13 cDNA Clone; KCNJ13 cdna clone
Ordering
For Research Use Only!
Sequence
atggacagcagtaattgcaaagttattgctcctctcctaagtcaaagataccggaggatggtcaccaaggatggccacagcacacttcaaatggatggcgctcaaagaggtcttgcatatcttcgagatgcttggggaatcctaatggacatgcgctggcgttggatgatgttggtcttttctgcttcttttgttgtccactggcttgtctttgcagtgctctggtatgttctggctgagatgaatggtgatctggaactagatcatgatgccccacctgaaaaccacactatctgtgtcaagtatatcaccagtttcacagctgcattctccttctccctggagacacaactcacaattggttatggtaccatgttccccagtggtgactgtccaagtgcaatcgccttacttgccatacaaatgctcctaggcctcatgctagaggcttttatcacaggtgcttttgtggcgaagattgcccggccaaaaaatcgagctttttcaattcgctttactgacatagcagtagtagctcacatggatggcaaacctaatcttatcttccaagtggccaacacccgacctagccctctaaccagtgtccgggtctcagctgtactctatcaggaaagagaaaatggcaaactctaccagaccagtgtggatttccaccttgatggcatcagttctgacgaatgtccattcttcatctttccactaacgtactatcactccattacaccatcaagtcctctggctactctgctccagcatgaaaatccttctcactttgaattagttgtattcctttcagcaatgcaggagggcactggagaaatatgccaaaggaggacatcctacctacagtctgaaatcatgttacatcactgttttgcatctctgttgacccgaggttccaaatgtgaatatcaaatcaagatggagaattttgacaagactgtccctgaatttccaactcctctggtttctaaaagcccaaacaggactgacctggatatccacatcaatggacaaagcattgacaattttcagatctctgaaacaggactgacagaataa
Sequence Length
1083
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
10,980 Da
NCBI Official Full Name
Homo sapiens potassium inwardly-rectifying channel, subfamily J, member 13, mRNA
NCBI Official Synonym Full Names
potassium voltage-gated channel subfamily J member 13
NCBI Official Symbol
KCNJ13
NCBI Official Synonym Symbols
SVD; LCA16; KIR1.4; KIR7.1
NCBI Protein Information
inward rectifier potassium channel 13
UniProt Protein Name
Inward rectifier potassium channel 13
UniProt Gene Name
KCNJ13
UniProt Entry Name
KCJ13_HUMAN

NCBI Description

This gene encodes a member of the inwardly rectifying potassium channel family of proteins. Members of this family form ion channel pores that allow potassium ions to pass into a cell. The encoded protein belongs to a subfamily of low signal channel conductance proteins that have a low dependence on potassium concentration. Mutations in this gene are associated with snowflake vitreoretinal degeneration. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Feb 2010]

Uniprot Description

KCNJ13: Inward rectifier potassium channels are characterized by a greater tendency to allow potassium to flow into the cell rather than out of it. Their voltage dependence is regulated by the concentration of extracellular potassium; as external potassium is raised, the voltage range of the channel opening shifts to more positive voltages. The inward rectification is mainly due to the blockage of outward current by internal magnesium. KCNJ13 has a very low single channel conductance, low sensitivity to block by external barium and cesium, and no dependence of its inward rectification properties on the internal blocking particle magnesium. Defects in KCNJ13 are the cause of snowflake vitreoretinal degeneration (SVD). SVD is a developmental and progressive hereditary eye disorder that affects multiple tissues within the eye. Diagnostic features of SVD include fibrillar degeneration of the vitreous humor, early-onset cataract, minute crystalline deposits in the neurosensory retina, and retinal detachment. Defects in KCNJ13 are the cause of Leber congenital amaurosis type 16 (LCA16). LCA16 is a severe dystrophy of the retina, typically becoming evident in the first years of life. Visual function is usually poor and often accompanied by nystagmus, sluggish or near-absent pupillary responses, photophobia, high hyperopia and keratoconus. Belongs to the inward rectifier-type potassium channel (TC 1.A.2.1) family. KCNJ13 subfamily. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, multi-pass; Membrane protein, integral; Channel, potassium

Chromosomal Location of Human Ortholog: 2q37

Cellular Component: integral to plasma membrane

Molecular Function: inward rectifier potassium channel activity

Biological Process: potassium ion import

Disease: Leber Congenital Amaurosis 16; Vitreoretinal Degeneration, Snowflake Type

Research Articles on KCNJ13

Similar Products

Product Notes

The KCNJ13 kcnj13 (Catalog #AAA1272991) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacagca gtaattgcaa agttattgct cctctcctaa gtcaaagata ccggaggatg gtcaccaagg atggccacag cacacttcaa atggatggcg ctcaaagagg tcttgcatat cttcgagatg cttggggaat cctaatggac atgcgctggc gttggatgat gttggtcttt tctgcttctt ttgttgtcca ctggcttgtc tttgcagtgc tctggtatgt tctggctgag atgaatggtg atctggaact agatcatgat gccccacctg aaaaccacac tatctgtgtc aagtatatca ccagtttcac agctgcattc tccttctccc tggagacaca actcacaatt ggttatggta ccatgttccc cagtggtgac tgtccaagtg caatcgcctt acttgccata caaatgctcc taggcctcat gctagaggct tttatcacag gtgcttttgt ggcgaagatt gcccggccaa aaaatcgagc tttttcaatt cgctttactg acatagcagt agtagctcac atggatggca aacctaatct tatcttccaa gtggccaaca cccgacctag ccctctaacc agtgtccggg tctcagctgt actctatcag gaaagagaaa atggcaaact ctaccagacc agtgtggatt tccaccttga tggcatcagt tctgacgaat gtccattctt catctttcca ctaacgtact atcactccat tacaccatca agtcctctgg ctactctgct ccagcatgaa aatccttctc actttgaatt agttgtattc ctttcagcaa tgcaggaggg cactggagaa atatgccaaa ggaggacatc ctacctacag tctgaaatca tgttacatca ctgttttgca tctctgttga cccgaggttc caaatgtgaa tatcaaatca agatggagaa ttttgacaag actgtccctg aatttccaac tcctctggtt tctaaaagcc caaacaggac tgacctggat atccacatca atggacaaag cattgacaat tttcagatct ctgaaacagg actgacagaa taa. It is sometimes possible for the material contained within the vial of "KCNJ13, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.