Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

KCNJ12 cdna clone

KCNJ12 cDNA Clone

Gene Names
KCNJ12; IRK2; hIRK; IRK-2; hIRK1; KCNJN1; Kir2.2; Kir2.2v; kcnj12x; hkir2.2x
Synonyms
KCNJ12; KCNJ12 cDNA Clone; KCNJ12 cdna clone
Ordering
For Research Use Only!
Sequence
atgaccgcggccagccgggccaacccctacagcatcgtgtcatcggaggaggacgggctgcacctggtcaccatgtcgggcgccaacggcttcggcaacggcaaggtgcacacgcggcgcaggtgccgcaaccgcttcgtcaagaagaatggccagtgcaacattgagttcgccaacatggacgagaagtcacagcgctacctggctgacatgttcaccacctgtgtggacatccgctggcggtacatgctgctcatcttctcgctggccttccttgcctcctggctgctgttcggcatcatcttctgggtcatcgcggtggcacacggtgacctggagccggctgagggccggggccgcacaccctgtgtgatgcaggtgcacggcttcatggcggccttcctcttctccatcgagacgcagaccaccatcggctacgggctgcgctgtgtgacggaggagtgcccggtggccgtcttcatggtggtggcccagtccatcgtgggctgcatcatcgactccttcatgattggtgccatcatggccaagatggcaaggcccaagaagcgggcacagacgctgctgttcagccacaacgccgtggtggccctgcgtgacggcaagctctgcctcatgtggcgtgtgggtaacctgcgcaagagccacattgtggaggcccatgtgcgcgcgcagctcatcaagccgcgggtcaccgaggagggcgagtacatcccgctggaccagatcgacatcgatgtgggcttcgacaagggcctggaccgcatctttctggtgtcgcccatcaccatcttgcatgagattgacgaggccagcccgctcttcggcatcagccggcaggacctggagacggacgactttgagatcgtggtcatcctggaaggcatggtggaggccacagccatgaccacccaggcccgcagctcctacctggccaatgagatcctgtggggtcaccgctttgagcccgtgctcttcgaggagaagaaccagtacaagattgactactcgcacttccacaagacctatgaggtgccctctacgccccgctgcagtgcgaaggatctggtagagaacaagttcctgctgcccagcgccaactccttctgctacgagaacgagctggccttcctgagccgtgacgaggaggatgaggcggacggagaccaggacggccgaagccgggacggcctcagcccccaggccaggcatgactttgacagactccaggctggcggcggggtcctggagcagcggccctacagacgggagtcagagatctga
Sequence Length
1302
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
49,001 Da
NCBI Official Full Name
Homo sapiens potassium inwardly-rectifying channel, subfamily J, member 12, mRNA
NCBI Official Synonym Full Names
potassium voltage-gated channel subfamily J member 12
NCBI Official Symbol
KCNJ12
NCBI Official Synonym Symbols
IRK2; hIRK; IRK-2; hIRK1; KCNJN1; Kir2.2; Kir2.2v; kcnj12x; hkir2.2x
NCBI Protein Information
ATP-sensitive inward rectifier potassium channel 12
UniProt Protein Name
ATP-sensitive inward rectifier potassium channel 12
UniProt Gene Name
KCNJ12
UniProt Synonym Gene Names
IRK2; KCNJN1; IRK-2
UniProt Entry Name
KCJ12_HUMAN

NCBI Description

This gene encodes an inwardly rectifying K+ channel which may be blocked by divalent cations. This protein is thought to be one of multiple inwardly rectifying channels which contribute to the cardiac inward rectifier current (IK1). The gene is located within the Smith-Magenis syndrome region on chromosome 17. [provided by RefSeq, Jul 2008]

Uniprot Description

KCNJ12: Probably participates in establishing action potential waveform and excitability of neuronal and muscle tissues. Inward rectifier potassium channels are characterized by a greater tendency to allow potassium to flow into the cell rather than out of it. Their voltage dependence is regulated by the concentration of extracellular potassium; as external potassium is raised, the voltage range of the channel opening shifts to more positive voltages. The inward rectification is mainly due to the blockage of outward current by internal magnesium. Can be blocked by extracellular barium and cesium. Belongs to the inward rectifier-type potassium channel (TC 1.A.2.1) family. KCNJ12 subfamily.

Protein type: Membrane protein, multi-pass; Membrane protein, integral

Chromosomal Location of Human Ortholog: 17p11.2

Cellular Component: integral to plasma membrane; intrinsic to membrane; plasma membrane

Molecular Function: G-protein activated inward rectifier potassium channel activity; inward rectifier potassium channel activity

Biological Process: muscle contraction; potassium ion import; potassium ion transport; protein homotetramerization; regulation of heart contraction

Research Articles on KCNJ12

Similar Products

Product Notes

The KCNJ12 kcnj12 (Catalog #AAA1270256) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaccgcgg ccagccgggc caacccctac agcatcgtgt catcggagga ggacgggctg cacctggtca ccatgtcggg cgccaacggc ttcggcaacg gcaaggtgca cacgcggcgc aggtgccgca accgcttcgt caagaagaat ggccagtgca acattgagtt cgccaacatg gacgagaagt cacagcgcta cctggctgac atgttcacca cctgtgtgga catccgctgg cggtacatgc tgctcatctt ctcgctggcc ttccttgcct cctggctgct gttcggcatc atcttctggg tcatcgcggt ggcacacggt gacctggagc cggctgaggg ccggggccgc acaccctgtg tgatgcaggt gcacggcttc atggcggcct tcctcttctc catcgagacg cagaccacca tcggctacgg gctgcgctgt gtgacggagg agtgcccggt ggccgtcttc atggtggtgg cccagtccat cgtgggctgc atcatcgact ccttcatgat tggtgccatc atggccaaga tggcaaggcc caagaagcgg gcacagacgc tgctgttcag ccacaacgcc gtggtggccc tgcgtgacgg caagctctgc ctcatgtggc gtgtgggtaa cctgcgcaag agccacattg tggaggccca tgtgcgcgcg cagctcatca agccgcgggt caccgaggag ggcgagtaca tcccgctgga ccagatcgac atcgatgtgg gcttcgacaa gggcctggac cgcatctttc tggtgtcgcc catcaccatc ttgcatgaga ttgacgaggc cagcccgctc ttcggcatca gccggcagga cctggagacg gacgactttg agatcgtggt catcctggaa ggcatggtgg aggccacagc catgaccacc caggcccgca gctcctacct ggccaatgag atcctgtggg gtcaccgctt tgagcccgtg ctcttcgagg agaagaacca gtacaagatt gactactcgc acttccacaa gacctatgag gtgccctcta cgccccgctg cagtgcgaag gatctggtag agaacaagtt cctgctgccc agcgccaact ccttctgcta cgagaacgag ctggccttcc tgagccgtga cgaggaggat gaggcggacg gagaccagga cggccgaagc cgggacggcc tcagccccca ggccaggcat gactttgaca gactccaggc tggcggcggg gtcctggagc agcggcccta cagacgggag tcagagatct ga. It is sometimes possible for the material contained within the vial of "KCNJ12, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.