Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

KCNH6 cdna clone

KCNH6 cDNA Clone

Gene Names
KCNH6; ERG2; ERG-2; HERG2; Kv11.2; hERG-2
Synonyms
KCNH6; KCNH6 cDNA Clone; KCNH6 cdna clone
Ordering
For Research Use Only!
Sequence
atgccggtccgcaggggccacgtcgctccccaaaacacttacctggacaccatcatccgcaagttcgagggccaaagtcggaagttcctgattgccaatgctcagatggagaactgcgccatcatttactgcaacgacggcttctgcgaactcttcggctactcccgagtggaggtgatgcagcaaccctgcacctgcgacttcctcacaggccccaacacaccaagcagcgccgtgtcccgcctagcgcaggccctgctgggggctgaggagtgcaaggtggacatcctctactaccgcaaggatgcctccagcttccgctgcctggtagatgtggtgcccgtgaagaacgaggacggggctgtcatcatgttcattctcaacttcgaggacctggcccagctcctggccaagtgcagcagccgcagcttgtcccagcgcctgttgtcccagagcttcctgggctccgagggctctcatggcaggccaggcggaccagggccaggcacaggcaggggcaagtacaggaccatcagccagatcccacagttcacgctcaacttcgtggagttcaacttggagaagcaccgctccagctccaccacggagattgagatcatcgcgccccataaggtggtggagcggacacagaacgtcactgagaaggtcacccaggtcctgtccctgggcgcggatgtgctgccggagtacaagctgcaggcgccgcgcatccaccgctggaccatcctgcactacagccccttcaaggccgtgtgggactggctcatcctgctgctggtcatctacacggctgtcttcacgccctactcagccgccttcctgctcagcgaccaggacgaatcacggcgtggggcctgcagctatacctgcagtcccctcactgtggtggatctcatcgtggacatcatgttcgtcgtggacatcgtcatcaacttccgcaccacctatgtcaacaccaatgatgaggtggtcagccacccccgccgcatcgccgtccactacttcaagggctggttcctcattgacatggtggccgccatccctttcgacctcctgatcttccgcactggctccgatgagaccacaaccctgattgggctattgaagacagcgcggctgctgcggctggtgcgcgtagcacggaagctggaccgctactctgagtatggggcggctgtgctcttcttgctcatgtgcaccttcgcgctcatagcgcactggctggcctgcatctggtacgccatcggcaatgtggagcggccctacctagaacacaagatcggctggctggacagcctgggtgtgcagcttggcaagcgctacaacggcagcgacccagcctcgggcccctcggtgcaggacaagtatgtcacagccctctacttcaccttcagcagcctcaccagcgtgggcttcggcaatgtctcgcccaacaccaactccgagaaggtcttctccatctgcgtcatgctcatcggctgtgagtga
Sequence Length
1509
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
56,298 Da
NCBI Official Full Name
Homo sapiens potassium voltage-gated channel, subfamily H (eag-related), member 6, mRNA
NCBI Official Synonym Full Names
potassium voltage-gated channel subfamily H member 6
NCBI Official Symbol
KCNH6
NCBI Official Synonym Symbols
ERG2; ERG-2; HERG2; Kv11.2; hERG-2
NCBI Protein Information
potassium voltage-gated channel subfamily H member 6
UniProt Protein Name
Potassium voltage-gated channel subfamily H member 6
UniProt Gene Name
KCNH6
UniProt Synonym Gene Names
ERG2; ERG-2; Eag-related protein 2; Ether-a-go-go-related protein 2; hERG-2; hERG2
UniProt Entry Name
KCNH6_HUMAN

NCBI Description

Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily H. This member is a pore-forming (alpha) subunit. Alternative splicing results in multiple transcript variants that encode different isoforms. [provided by RefSeq, Jul 2013]

Uniprot Description

Kv11.2: Pore-forming (alpha) subunit of voltage-gated potassium channel. Elicits a slowly activating, rectifying current. Channel properties may be modulated by cAMP and subunit assembly. Belongs to the potassium channel family. H (Eag) (TC 1.A.1.20) subfamily. Kv11.2/KCNH6 sub-subfamily. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, multi-pass; Channel, potassium; Membrane protein, integral

Chromosomal Location of Human Ortholog: 17q23.3

Cellular Component: integral to plasma membrane; plasma membrane

Molecular Function: voltage-gated potassium channel activity

Biological Process: regulation of membrane potential

Research Articles on KCNH6

Similar Products

Product Notes

The KCNH6 kcnh6 (Catalog #AAA1275614) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccggtcc gcaggggcca cgtcgctccc caaaacactt acctggacac catcatccgc aagttcgagg gccaaagtcg gaagttcctg attgccaatg ctcagatgga gaactgcgcc atcatttact gcaacgacgg cttctgcgaa ctcttcggct actcccgagt ggaggtgatg cagcaaccct gcacctgcga cttcctcaca ggccccaaca caccaagcag cgccgtgtcc cgcctagcgc aggccctgct gggggctgag gagtgcaagg tggacatcct ctactaccgc aaggatgcct ccagcttccg ctgcctggta gatgtggtgc ccgtgaagaa cgaggacggg gctgtcatca tgttcattct caacttcgag gacctggccc agctcctggc caagtgcagc agccgcagct tgtcccagcg cctgttgtcc cagagcttcc tgggctccga gggctctcat ggcaggccag gcggaccagg gccaggcaca ggcaggggca agtacaggac catcagccag atcccacagt tcacgctcaa cttcgtggag ttcaacttgg agaagcaccg ctccagctcc accacggaga ttgagatcat cgcgccccat aaggtggtgg agcggacaca gaacgtcact gagaaggtca cccaggtcct gtccctgggc gcggatgtgc tgccggagta caagctgcag gcgccgcgca tccaccgctg gaccatcctg cactacagcc ccttcaaggc cgtgtgggac tggctcatcc tgctgctggt catctacacg gctgtcttca cgccctactc agccgccttc ctgctcagcg accaggacga atcacggcgt ggggcctgca gctatacctg cagtcccctc actgtggtgg atctcatcgt ggacatcatg ttcgtcgtgg acatcgtcat caacttccgc accacctatg tcaacaccaa tgatgaggtg gtcagccacc cccgccgcat cgccgtccac tacttcaagg gctggttcct cattgacatg gtggccgcca tccctttcga cctcctgatc ttccgcactg gctccgatga gaccacaacc ctgattgggc tattgaagac agcgcggctg ctgcggctgg tgcgcgtagc acggaagctg gaccgctact ctgagtatgg ggcggctgtg ctcttcttgc tcatgtgcac cttcgcgctc atagcgcact ggctggcctg catctggtac gccatcggca atgtggagcg gccctaccta gaacacaaga tcggctggct ggacagcctg ggtgtgcagc ttggcaagcg ctacaacggc agcgacccag cctcgggccc ctcggtgcag gacaagtatg tcacagccct ctacttcacc ttcagcagcc tcaccagcgt gggcttcggc aatgtctcgc ccaacaccaa ctccgagaag gtcttctcca tctgcgtcat gctcatcggc tgtgagtga. It is sometimes possible for the material contained within the vial of "KCNH6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.