Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

KCNE4 cdna clone

KCNE4 cDNA Clone

Gene Names
KCNE4; MIRP3
Synonyms
KCNE4; KCNE4 cDNA Clone; KCNE4 cdna clone
Ordering
For Research Use Only!
Sequence
atgctgaaaatggagcctctgaacagcacgcaccccggcaccgccgcctccagcagccccctggagtcccgtgcggccggtggcggcagcggcaatggcaacgagtacttctacattctggttgtcatgtccttctacggcattttcttgatcggaatcatgctgggctacatgaaatccaagaggcgggagaagaagtccagcctcctgctgctgtacaaagacgaggagcggctctggggggaggccatgaagccgctgcccgtggtgtcgggcctgaggtcggtgcaggtgcccctgatgctgaacatgctgcaggagagcgtggcgcccgcgctgtcctgcaccctctgttccatggaaggggacagcgtgagctccgagtcctcctccccggacgtgcacctcaccattcaggaggagggggcagacgaggagctggaggagacctcggagacgcccctcaacgagagcagcgaagggtcctcggagaacatccatcagaattcctag
Sequence Length
513
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
23,806 Da
NCBI Official Full Name
Homo sapiens potassium voltage-gated channel, Isk-related family, member 4, mRNA
NCBI Official Synonym Full Names
potassium voltage-gated channel subfamily E regulatory subunit 4
NCBI Official Symbol
KCNE4
NCBI Official Synonym Symbols
MIRP3
NCBI Protein Information
potassium voltage-gated channel subfamily E member 4
UniProt Protein Name
Potassium voltage-gated channel subfamily E member 4
UniProt Gene Name
KCNE4
UniProt Entry Name
KCNE4_HUMAN

NCBI Description

Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, isk-related subfamily. This member is a type I membrane protein, and a beta subunit that assembles with a potassium channel alpha-subunit to modulate the gating kinetics and enhance stability of the multimeric complex. This gene is prominently expressed in the embryo and in adult uterus. [provided by RefSeq, Jul 2008]

Uniprot Description

KCNE4: Ancillary protein that assembles as a beta subunit with a voltage-gated potassium channel complex of pore-forming alpha subunits. Modulates the gating kinetics and enhances stability of the channel complex. May associate with KCNQ1/KVLTQ1 and inhibit potassium current. Belongs to the potassium channel KCNE family.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 2q36.1

Molecular Function: protein binding

Research Articles on KCNE4

Similar Products

Product Notes

The KCNE4 kcne4 (Catalog #AAA1278442) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgaaaa tggagcctct gaacagcacg caccccggca ccgccgcctc cagcagcccc ctggagtccc gtgcggccgg tggcggcagc ggcaatggca acgagtactt ctacattctg gttgtcatgt ccttctacgg cattttcttg atcggaatca tgctgggcta catgaaatcc aagaggcggg agaagaagtc cagcctcctg ctgctgtaca aagacgagga gcggctctgg ggggaggcca tgaagccgct gcccgtggtg tcgggcctga ggtcggtgca ggtgcccctg atgctgaaca tgctgcagga gagcgtggcg cccgcgctgt cctgcaccct ctgttccatg gaaggggaca gcgtgagctc cgagtcctcc tccccggacg tgcacctcac cattcaggag gagggggcag acgaggagct ggaggagacc tcggagacgc ccctcaacga gagcagcgaa gggtcctcgg agaacatcca tcagaattcc tag. It is sometimes possible for the material contained within the vial of "KCNE4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.