KBTBD4 cdna clone
KBTBD4 cDNA Clone
Gene Names
KBTBD4; BKLHD4; HSPC252
Synonyms
KBTBD4; KBTBD4 cDNA Clone; KBTBD4 cdna clone
Sequence
atggaatcaccagaggagcctggagcatccatggatgagaactactttgtgaactacactttcaaagatcggtcacattcaggccgtgtggctcaaggcatcatgaaactgtgtctagaggaggagctctttgctgatgtcaccatttcggtggaaggccgggagtttcagctccatcggctggtcctctcagctcagagctgcttcttccgatccatgttcacttccaacctgaaggaggcccacaaccgggtgattgtgctgcaggatgtcagcgagtctgttttccagctcctggttgattatatctaccatgggactgtgaaacttcgagctgaggagttgcaggaaatttatgaggtgtcagacatgtatcagctgacatctctctttgaggaatgctctcggtttttggcccgcacagtgcaagtgggaaactgccttcaggtgatgtggctggcagatcggcacagtgatcctgagctctatacggctgccaagcactgtgccaagacccacctggcccagctgcagaatacagaggaatttctccacttgccccaccgcttactcacagatatcatctcggatggagttccgtgttctcagaacccaacagaggcaatagaagcctggatcaactttaataaagaggaaagagaggcttttgcagagtcactcaggacaagcttgaaggaaattggggagaatgtgcacatttacctgattgggaaagagtcatctcgtacccactcgttggctgtgtccttgcactgtgcagaagatgactccatcagtgtaagtggccaaaacagtttgtgccaccagatcactgcggcctgcaagcatggtggagacttgtatgtggtgggagggtccatcccacggcgcatgtggaagtgcaacaatgccaccgttgactgggagtggtgtgctcctttgcctcgggaccggctccagcacaccctggtgtctgtgcccgggaaagatgccatatattcactgggtggcaagacactgcaagataccctctccaacgcagtcatttattatcgcgtaggtgataatgtgtggacagagacaactcagctagaggtggctgtgtcaggggctgctggtgccaacctcaacgggatcatctacttactagggggggaggagaatgatctggacttctttaccaaaccttcccgactcatccagtgctttgacacagagacagacaaatgccatgtgaagccctatgtgctgccctttgcaggccgcatgcacgcagctgtgcataaagatctggtgttcatcgtggctgaaggggactccctggtgtgctacaatcccttgctagacagcttcacccggctttgccttcctgaggcctggagctctgccccatccctctggaagattgccagctgtaacgggagcatctatgtcttccgggaccgatataaaaagggggatgccaacacctacaagcttgaccctgccacttcagccgtaactgtcacaagaggtattaaggtgctgcttaccaatttgcagtttgtgttggcctaa
Sequence Length
1557
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
59,904 Da
NCBI Official Full Name
Homo sapiens kelch repeat and BTB (POZ) domain containing 4, mRNA
NCBI Official Synonym Full Names
kelch repeat and BTB domain containing 4
NCBI Official Symbol
KBTBD4
NCBI Official Synonym Symbols
BKLHD4; HSPC252
NCBI Protein Information
kelch repeat and BTB domain-containing protein 4
UniProt Protein Name
Kelch repeat and BTB domain-containing protein 4
Protein Family
UniProt Gene Name
KBTBD4
UniProt Synonym Gene Names
BKLHD4
UniProt Entry Name
KBTB4_HUMAN
Uniprot Description
KBTBD4: 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Unknown function
Chromosomal Location of Human Ortholog: 11p11.2
Similar Products
Product Notes
The KBTBD4 kbtbd4 (Catalog #AAA1266636) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaatcac cagaggagcc tggagcatcc atggatgaga actactttgt gaactacact ttcaaagatc ggtcacattc aggccgtgtg gctcaaggca tcatgaaact gtgtctagag gaggagctct ttgctgatgt caccatttcg gtggaaggcc gggagtttca gctccatcgg ctggtcctct cagctcagag ctgcttcttc cgatccatgt tcacttccaa cctgaaggag gcccacaacc gggtgattgt gctgcaggat gtcagcgagt ctgttttcca gctcctggtt gattatatct accatgggac tgtgaaactt cgagctgagg agttgcagga aatttatgag gtgtcagaca tgtatcagct gacatctctc tttgaggaat gctctcggtt tttggcccgc acagtgcaag tgggaaactg ccttcaggtg atgtggctgg cagatcggca cagtgatcct gagctctata cggctgccaa gcactgtgcc aagacccacc tggcccagct gcagaataca gaggaatttc tccacttgcc ccaccgctta ctcacagata tcatctcgga tggagttccg tgttctcaga acccaacaga ggcaatagaa gcctggatca actttaataa agaggaaaga gaggcttttg cagagtcact caggacaagc ttgaaggaaa ttggggagaa tgtgcacatt tacctgattg ggaaagagtc atctcgtacc cactcgttgg ctgtgtcctt gcactgtgca gaagatgact ccatcagtgt aagtggccaa aacagtttgt gccaccagat cactgcggcc tgcaagcatg gtggagactt gtatgtggtg ggagggtcca tcccacggcg catgtggaag tgcaacaatg ccaccgttga ctgggagtgg tgtgctcctt tgcctcggga ccggctccag cacaccctgg tgtctgtgcc cgggaaagat gccatatatt cactgggtgg caagacactg caagataccc tctccaacgc agtcatttat tatcgcgtag gtgataatgt gtggacagag acaactcagc tagaggtggc tgtgtcaggg gctgctggtg ccaacctcaa cgggatcatc tacttactag ggggggagga gaatgatctg gacttcttta ccaaaccttc ccgactcatc cagtgctttg acacagagac agacaaatgc catgtgaagc cctatgtgct gccctttgca ggccgcatgc acgcagctgt gcataaagat ctggtgttca tcgtggctga aggggactcc ctggtgtgct acaatccctt gctagacagc ttcacccggc tttgccttcc tgaggcctgg agctctgccc catccctctg gaagattgcc agctgtaacg ggagcatcta tgtcttccgg gaccgatata aaaaggggga tgccaacacc tacaagcttg accctgccac ttcagccgta actgtcacaa gaggtattaa ggtgctgctt accaatttgc agtttgtgtt ggcctaa. It is sometimes possible for the material contained within the vial of "KBTBD4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
