Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

KANK2 cdna clone

KANK2 cDNA Clone

Gene Names
KANK2; SIP; MXRA3; PPKWH; ANKRD25
Synonyms
KANK2; KANK2 cDNA Clone; KANK2 cdna clone
Ordering
For Research Use Only!
Sequence
atggcccaggtcctgcacgtgcctgctcccttcccagggacccctggcccagcctccccacctgccttccctgccaaggaccccgatccaccctactccgtggagaccccctatggctaccgcctggacctggacttcctcaagtacgtggatgacatcgagaagggccacacgctgcgacgcgtggcagtgcagcgccgcccccgcctgagctcgctgccccgtggccctggctcctggtggacgtccactgagtcgctgtgctccaatgccagtggggacagccgccactcagcctattcctactgcggccgtggcttctaccctcagtatggtgctctggagacccgcggtggcttcaatccgcgggtggagcgcacgctgctggatgcccgtcgccgtctcgaggaccaggcggccacacccaccggcctgggctccctgacccccagtgcggccggctcgacagcctccctggtgggcgtggggttgccacccccgacaccacggagttcaggactgtccacaccggtgcctcccagtgccgggcacctggcccacgtgcgggagcagatggcgggtgccctgcggaagctgcggcagctggaggagcaggtgaagctgatccctgtgctccaggtgaagctctcggtgctccaggaggaaaagcggcagctcacagtacaacttaagagccagaagttcctgggccaccccacagcgggccggggtcgcagcgagctctgcctggacctccccgatcccccagaggacccagtggcactggagacccggagtgtgggcacctgggttcgagaacgggacttgggcatgcctgatggggaggctgccctcgccgccaaggtcgctgtgctggagacccagctcaagaaggcgctgcaggagctgcaggcagctcaggcccggcaggctgacccccagccccaggcctggccaccgccggacagcccggtccgcgtggatacagtccgggtggtagaagggccacgggaggtggaggtggtggccagcacagccgctggcgcccccgcacagcgggcccagagcctggagccttacggcacagggctgagggccctggcaatgcctggtaggcctgagagcccacctgtgttccgcagccaggaggtggtggagacaatgtgcccagtgcccgctgcagctaccagcaacgtccatatggtgaagaagattagcatcacagagcgaagctgcgatggagcagcaggcctcccagaagttcctgccgaatcgtcttcgtcacccccggggtccgaggtagcctcccttacacagcctgagaagagcacaggccgagtgcccacccaggagcccacccacagggagcccaccaggcaagcagcctcccaagagtccgaggaggccgggggcaccggcgggcccccggcaggcgtgcgatctatcatgaaacggaaagaggaggttgcagaccccacggcccaccggaggagcctccagttcgtgggggtcaacggcgggtatgagtcgtcatccgaggactccagcacagcagagaacatctcagacaacgacagcacagagaacgaggccccagagccgagggagagggttccgagtgtggccgaagccccccagctcaggcctgcagggacggcagcggccaagaccagccggcaggagtgtcagctgtctcgagaatctcagcacatacccactgctgagggggcatcaggatcaaacacggaggaggagatcaggatggagctaagccctgacctcatctcagcctgcttggccctggaaaagtacctggacaatcccaacgccctcacagagcgggagctgaaagtggcctacaccacagtgctgcaggagtggctgcgcctggcctgccgcagcgacgcacaccccgagctggtgcggcggcacctggtcacgttccgggccatgtctgcgcggctgctggactacgtggtcaacatcgccgacagcaacggcaacacagccctgcactactccgtgtctcatgccaacttccccgtggtgcagcagctgctcgacagcggtgtctgcaaggtggacaaacagaaccgtgctggctacagccctattatgctcaccgccctggccaccctgaagacccaggacgacatcgagactgtccttcagctcttccggcttggcaacatcaatgccaaagccagccaggcaggacagacggccctgatgctggccgtcagccacgggcgggtggacgttgtcaaagccctgctggcctgtgaggcagatgtcaacgtgcaagatgatgacggctccacggccctcatgtgcgcctgtgagcacggccacaaggagatcgcggggctgctgctggccgtgcccagctgtgacatctcactcacagatcgcgatgggagcacagctctgatggtggccttggacgcagggcagagtgagattgcgtccatgctgtattcccgcatgaacatcaagtgctcgtttgccccaatgtcagatgacgagagccctacatcatcctcggcagaagagtag
Sequence Length
2556
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
90,044 Da
NCBI Official Full Name
Homo sapiens KN motif and ankyrin repeat domains 2, mRNA
NCBI Official Synonym Full Names
KN motif and ankyrin repeat domains 2
NCBI Official Symbol
KANK2
NCBI Official Synonym Symbols
SIP; MXRA3; PPKWH; ANKRD25
NCBI Protein Information
KN motif and ankyrin repeat domain-containing protein 2
UniProt Protein Name
KN motif and ankyrin repeat domain-containing protein 2
UniProt Gene Name
KANK2
UniProt Synonym Gene Names
ANKRD25; KIAA1518; MXRA3; SIP; SIP; SRC-interacting protein; SRC1-interacting protein
UniProt Entry Name
KANK2_HUMAN

NCBI Description

This gene encodes a member of the KN motif and ankyrin repeat domains (KANK) family of proteins, which play a role in cytoskeletal formation by regulating actin polymerization. The encoded protein functions in the sequestration of steroid receptor coactivators and possibly other proteins. Mutations in this gene are associated with impaired kidney podocyte function and nephrotic syndrome, and keratoderma and woolly hair. [provided by RefSeq, Jul 2016]

Uniprot Description

ANKRD25: a mammalian growth regulatory protein containing five Ankyrin repeats, common protein-protein interaction motifs. Ankyrin repeats are found in proteins with diverse functions including transcriptional initiators, cell-cycle regulators, cytoskeletal, and ion transporters. Three alternatively spliced isoforms have been described.

Protein type: Transcription regulation

Chromosomal Location of Human Ortholog: 19p13.2

Cellular Component: cytoplasm; mitochondrion

Molecular Function: protein binding

Biological Process: negative regulation of cell proliferation; negative regulation of estrogen receptor signaling pathway; negative regulation of programmed cell death; negative regulation of transcription from RNA polymerase II promoter

Disease: Palmoplantar Keratoderma And Woolly Hair

Research Articles on KANK2

Similar Products

Product Notes

The KANK2 kank2 (Catalog #AAA1273693) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcccagg tcctgcacgt gcctgctccc ttcccaggga cccctggccc agcctcccca cctgccttcc ctgccaagga ccccgatcca ccctactccg tggagacccc ctatggctac cgcctggacc tggacttcct caagtacgtg gatgacatcg agaagggcca cacgctgcga cgcgtggcag tgcagcgccg cccccgcctg agctcgctgc cccgtggccc tggctcctgg tggacgtcca ctgagtcgct gtgctccaat gccagtgggg acagccgcca ctcagcctat tcctactgcg gccgtggctt ctaccctcag tatggtgctc tggagacccg cggtggcttc aatccgcggg tggagcgcac gctgctggat gcccgtcgcc gtctcgagga ccaggcggcc acacccaccg gcctgggctc cctgaccccc agtgcggccg gctcgacagc ctccctggtg ggcgtggggt tgccaccccc gacaccacgg agttcaggac tgtccacacc ggtgcctccc agtgccgggc acctggccca cgtgcgggag cagatggcgg gtgccctgcg gaagctgcgg cagctggagg agcaggtgaa gctgatccct gtgctccagg tgaagctctc ggtgctccag gaggaaaagc ggcagctcac agtacaactt aagagccaga agttcctggg ccaccccaca gcgggccggg gtcgcagcga gctctgcctg gacctccccg atcccccaga ggacccagtg gcactggaga cccggagtgt gggcacctgg gttcgagaac gggacttggg catgcctgat ggggaggctg ccctcgccgc caaggtcgct gtgctggaga cccagctcaa gaaggcgctg caggagctgc aggcagctca ggcccggcag gctgaccccc agccccaggc ctggccaccg ccggacagcc cggtccgcgt ggatacagtc cgggtggtag aagggccacg ggaggtggag gtggtggcca gcacagccgc tggcgccccc gcacagcggg cccagagcct ggagccttac ggcacagggc tgagggccct ggcaatgcct ggtaggcctg agagcccacc tgtgttccgc agccaggagg tggtggagac aatgtgccca gtgcccgctg cagctaccag caacgtccat atggtgaaga agattagcat cacagagcga agctgcgatg gagcagcagg cctcccagaa gttcctgccg aatcgtcttc gtcacccccg gggtccgagg tagcctccct tacacagcct gagaagagca caggccgagt gcccacccag gagcccaccc acagggagcc caccaggcaa gcagcctccc aagagtccga ggaggccggg ggcaccggcg ggcccccggc aggcgtgcga tctatcatga aacggaaaga ggaggttgca gaccccacgg cccaccggag gagcctccag ttcgtggggg tcaacggcgg gtatgagtcg tcatccgagg actccagcac agcagagaac atctcagaca acgacagcac agagaacgag gccccagagc cgagggagag ggttccgagt gtggccgaag ccccccagct caggcctgca gggacggcag cggccaagac cagccggcag gagtgtcagc tgtctcgaga atctcagcac atacccactg ctgagggggc atcaggatca aacacggagg aggagatcag gatggagcta agccctgacc tcatctcagc ctgcttggcc ctggaaaagt acctggacaa tcccaacgcc ctcacagagc gggagctgaa agtggcctac accacagtgc tgcaggagtg gctgcgcctg gcctgccgca gcgacgcaca ccccgagctg gtgcggcggc acctggtcac gttccgggcc atgtctgcgc ggctgctgga ctacgtggtc aacatcgccg acagcaacgg caacacagcc ctgcactact ccgtgtctca tgccaacttc cccgtggtgc agcagctgct cgacagcggt gtctgcaagg tggacaaaca gaaccgtgct ggctacagcc ctattatgct caccgccctg gccaccctga agacccagga cgacatcgag actgtccttc agctcttccg gcttggcaac atcaatgcca aagccagcca ggcaggacag acggccctga tgctggccgt cagccacggg cgggtggacg ttgtcaaagc cctgctggcc tgtgaggcag atgtcaacgt gcaagatgat gacggctcca cggccctcat gtgcgcctgt gagcacggcc acaaggagat cgcggggctg ctgctggccg tgcccagctg tgacatctca ctcacagatc gcgatgggag cacagctctg atggtggcct tggacgcagg gcagagtgag attgcgtcca tgctgtattc ccgcatgaac atcaagtgct cgtttgcccc aatgtcagat gacgagagcc ctacatcatc ctcggcagaa gagtag. It is sometimes possible for the material contained within the vial of "KANK2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.