ITLN1 cdna clone
ITLN1 cDNA Clone
Gene Names
ITLN1; HL1; LFR; HL-1; INTL; ITLN; hIntL; omentin
Synonyms
ITLN1; ITLN1 cDNA Clone; ITLN1 cdna clone
Sequence
atgaaccaactcagcttcctgctgtttctcatagcgaccaccagaggatggagtacagatgaggctaatacttacttcaaggaatggacctgttcttcgtctccatctctgcccagaagctgcaaggaaatcaaagacgaatgtcctagtgcatttgatggcctgtattttctccgcactgagaatggtgttatctaccagaccttctgtgacatgacctctgggggtggcggctggaccctggtggccagcgtgcacgagaatgacatgcgtgggaagtgcacggtgggcgatcgctggtccagtcagcagggcagcaaagcagtctacccagagggggacggcaactgggccaactacaacacctttggatctgcagaggcggccacgagcgatgactacaagaaccctggctactacgacatccaggccaaggacctgggcatctggcacgtgcccaataagtcccccatgcagcactggagaaacagctccctgctgaggtaccgcacggacactggcttcctccagacactgggacataatctgtttggcatctaccagaaatatccagtgaaatatggagaaggaaagtgttggactgacaacggcccggtgatccctgtggtctatgattttggcgacgcccagaaaacagcatcttattactcaccctatggccagcgggaattcactgcgggatttgttcagttcagggtatttaataacgagagagcagccaacgccttgtgtgctggaatgagggtcaccggatgtaacactgagcaccactgcattggtggaggaggatactttccagaggccagtccccagcagtgtggagatttttctggttttgattggagtggatatggaactcatgttggttacagcagcagccgtgagataactgaggcagctgtgcttctattctatcgttga
Sequence Length
942
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
34,962 Da
NCBI Official Full Name
Homo sapiens intelectin 1 (galactofuranose binding), mRNA
NCBI Official Synonym Full Names
intelectin 1
NCBI Official Symbol
ITLN1
NCBI Official Synonym Symbols
HL1; LFR; HL-1; INTL; ITLN; hIntL; omentin
NCBI Protein Information
intelectin-1
UniProt Protein Name
Intelectin-1
Protein Family
UniProt Gene Name
ITLN1
UniProt Synonym Gene Names
INTL; ITLN; LFR; ITLN-1
UniProt Entry Name
ITLN1_HUMAN
Uniprot Description
ITLN1: Has no effect on basal glucose uptake but enhances insulin-stimulated glucose uptake in adipocytes. Increases AKT phosphorylation in the absence and presence of insulin. May play a role in the defense system against microorganisms. May specifically recognize carbohydrate chains of pathogens and bacterial components containing galactofuranosyl residues, in a calcium-dependent manner. May be involved in iron metabolism.
Protein type: Membrane protein, GPI anchor
Chromosomal Location of Human Ortholog: 1q21.3
Cellular Component: brush border membrane; lipid raft; receptor complex
Biological Process: positive regulation of glucose import; positive regulation of protein amino acid phosphorylation; response to nematode
Research Articles on ITLN1
1. Plasma omentin-1 concentrations were decreased in non-obese polycystic ovary syndrome individuals
Similar Products
Product Notes
The ITLN1 itln1 (Catalog #AAA1268024) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaccaac tcagcttcct gctgtttctc atagcgacca ccagaggatg gagtacagat gaggctaata cttacttcaa ggaatggacc tgttcttcgt ctccatctct gcccagaagc tgcaaggaaa tcaaagacga atgtcctagt gcatttgatg gcctgtattt tctccgcact gagaatggtg ttatctacca gaccttctgt gacatgacct ctgggggtgg cggctggacc ctggtggcca gcgtgcacga gaatgacatg cgtgggaagt gcacggtggg cgatcgctgg tccagtcagc agggcagcaa agcagtctac ccagaggggg acggcaactg ggccaactac aacacctttg gatctgcaga ggcggccacg agcgatgact acaagaaccc tggctactac gacatccagg ccaaggacct gggcatctgg cacgtgccca ataagtcccc catgcagcac tggagaaaca gctccctgct gaggtaccgc acggacactg gcttcctcca gacactggga cataatctgt ttggcatcta ccagaaatat ccagtgaaat atggagaagg aaagtgttgg actgacaacg gcccggtgat ccctgtggtc tatgattttg gcgacgccca gaaaacagca tcttattact caccctatgg ccagcgggaa ttcactgcgg gatttgttca gttcagggta tttaataacg agagagcagc caacgccttg tgtgctggaa tgagggtcac cggatgtaac actgagcacc actgcattgg tggaggagga tactttccag aggccagtcc ccagcagtgt ggagattttt ctggttttga ttggagtgga tatggaactc atgttggtta cagcagcagc cgtgagataa ctgaggcagc tgtgcttcta ttctatcgtt ga. It is sometimes possible for the material contained within the vial of "ITLN1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
