Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ITGB3BP cdna clone

ITGB3BP cDNA Clone

Gene Names
ITGB3BP; CENPR; NRIF3; TAP20; CENP-R; HSU37139
Synonyms
ITGB3BP; ITGB3BP cDNA Clone; ITGB3BP cdna clone
Ordering
For Research Use Only!
Sequence
atgagtctatttgcttctcccacaagttctgaagagcaaaagcacagaaatggactatcaaatgaaaagagaaaaaaattgaatcaccccagtttaactgaaagcaaagaatctacaacaaaagacaatgatgaattcatgatgttgctatcaaaagttgagaaattgtcagaagaaatcatggagataatgcaaaatttaagtagtatacaggctttggagggcagtagagagcttgaaaatctcattggaatctcctgtgcatcacatttcttaaaaagagaaatgcagaaaaccaaagaactaatgacaaaagtgaataaacaaaaactgtttgaaaagagtacaggacttcctcacaaagcatcacgtcatcttgacagctatgaattccttaaagccattttaaactga
Sequence Length
414
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
24,729 Da
NCBI Official Full Name
Homo sapiens integrin beta 3 binding protein (beta3-endonexin), mRNA
NCBI Official Synonym Full Names
integrin subunit beta 3 binding protein
NCBI Official Symbol
ITGB3BP
NCBI Official Synonym Symbols
CENPR; NRIF3; TAP20; CENP-R; HSU37139
NCBI Protein Information
centromere protein R
UniProt Protein Name
Centromere protein R
Protein Family
UniProt Gene Name
ITGB3BP
UniProt Synonym Gene Names
CENPR; NRIF3; CENP-R
UniProt Entry Name
CENPR_HUMAN

NCBI Description

This gene encodes a transcriptional coregulator that binds to and enhances the activity of members of the nuclear receptor families, thyroid hormone receptors and retinoid X receptors. This protein also acts as a corepressor of NF-kappaB-dependent signaling. This protein induces apoptosis in breast cancer cells through a caspase 2-mediated signaling pathway. This protein is also a component of the centromere-specific histone H3 variant nucleosome associated complex (CENP-NAC) and may be involved in mitotic progression by recruiting the histone H3 variant CENP-A to the centromere. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011]

Uniprot Description

NRIF3: Transcription coregulator that can have both coactivator and corepressor functions. Isoform 1, but not other isoforms, is involved in the coactivation of nuclear receptors for retinoid X (RXRs) and thyroid hormone (TRs) in a ligand-dependent fashion. In contrast, it does not coactivate nuclear receptors for retinoic acid, vitamin D, progesterone receptor, nor glucocorticoid. Acts as a coactivator for estrogen receptor alpha. Acts as a transcriptional corepressor via its interaction with the NFKB1 NF- kappa-B subunit, possibly by interfering with the transactivation domain of NFKB1. Induces apoptosis in breast cancer cells, but not in other cancer cells, via a caspase-2 mediated pathway that involves mitochondrial membrane permeabilization but does not require other caspases. May also act as an inhibitor of cyclin A- associated kinase. Also acts a component of the CENPA-CAD (nucleosome distal) complex, a complex recruited to centromeres which is involved in assembly of kinetochore proteins, mitotic progression and chromosome segregation. May be involved in incorporation of newly synthesized CENPA into centromeres via its interaction with the CENPA-NAC complex. Homodimer; mediated by the coiled coil domain. Isoform 3, but not other isoforms, interacts with the cytoplasmic tail of integrin ITGB3. The relevance of the interaction with ITGB3 is however uncertain, since isoform 3 is mainly nuclear. Interacts with CCNA2 and MTA1. Interacts with NFKB1 NF-kappa-B subunit. Component of the CENPA-CAD complex, composed of CENPI, CENPK, CENPL, CENPO, CENPP, CENPQ, CENPR and CENPS. The CENPA-CAD complex interacts with the CENPA-NAC complex, at least composed of CENPA, CENPC, CENPH, CENPM, CENPN, CENPT and MLF1IP/CENPU. By estrogen. Widely expressed. Expressed in spleen, thymus, prostate, ovary, small intestine and white blood cells. Highly expressed in testis and colon. Isoform 4 is expressed in platelets, lymphocytes and granulocytes. 5 isoforms of the human protein are produced by alternative splicing.

Protein type: Cell adhesion; Motility/polarity/chemotaxis; Nuclear receptor co-regulator; Transcription, coactivator/corepressor

Chromosomal Location of Human Ortholog: 1p31.3

Cellular Component: cytoplasm; cytosol; membrane; nucleoplasm; nucleus

Molecular Function: protein binding; protein C-terminus binding; signal transducer activity

Biological Process: cell adhesion; DNA replication-independent nucleosome assembly at centromere; positive regulation of apoptosis; signal transduction; sister chromatid cohesion

Research Articles on ITGB3BP

Similar Products

Product Notes

The ITGB3BP itgb3bp (Catalog #AAA1271140) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagtctat ttgcttctcc cacaagttct gaagagcaaa agcacagaaa tggactatca aatgaaaaga gaaaaaaatt gaatcacccc agtttaactg aaagcaaaga atctacaaca aaagacaatg atgaattcat gatgttgcta tcaaaagttg agaaattgtc agaagaaatc atggagataa tgcaaaattt aagtagtata caggctttgg agggcagtag agagcttgaa aatctcattg gaatctcctg tgcatcacat ttcttaaaaa gagaaatgca gaaaaccaaa gaactaatga caaaagtgaa taaacaaaaa ctgtttgaaa agagtacagg acttcctcac aaagcatcac gtcatcttga cagctatgaa ttccttaaag ccattttaaa ctga. It is sometimes possible for the material contained within the vial of "ITGB3BP, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.