Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

IRGM cdna clone

IRGM cDNA Clone

Gene Names
IRGM; IFI1; IRGM1; LRG47; LRG-47
Synonyms
IRGM; IRGM cDNA Clone; IRGM cdna clone
Ordering
For Research Use Only!
Sequence
ATGAATGTTGAGAAAGCCTCAGCAGATGGGAACTTGCCAGAGGTGATCTCTAACATCAAGGAGACTCTGAAGATAGTGTCCAGGACACCAGTTAACATCACTATGGCAGGGGACTCTGGCAATGGGATGTCCACCTTCATCAGTGCCCTTCGAAACACAGGACATGAGGGTAAGGCCTCACCTCCTACTGAGCTGGTAAAAGCTACCCAAAGATGTGCCTCCTATTTCTCTTCCCACTTTTCAAATGTGGTGTTGTGGGACCTGCCTGGCACAGGGTCTGCCACCACAACCCTGGAGAACTACCTGATGGAAATGCAGTTCAACCGGTATGACTTCATCATGGTTGCATCTGCACAATTCAGCATGAATCATGTGATGCTTGCCAAAACCGCTGAGGACATGGGAAAGAAGTTCTACATTGTCTGGACCAAGCTAGACATGGACCTCAGCACAGGTGCCCTCCCAGAAGTGCAGCTACTGCAGATCAGAGAAAATGTCCTGGAAAATCTCCAGAAGGAGCGGGTATGTGAATACTAA
Sequence Length
537
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
20,142 Da
NCBI Official Full Name
Homo sapiens immunity-related GTPase family, M, mRNA
NCBI Official Synonym Full Names
immunity related GTPase M
NCBI Official Symbol
IRGM
NCBI Official Synonym Symbols
IFI1; IRGM1; LRG47; LRG-47
NCBI Protein Information
immunity-related GTPase family M protein
UniProt Protein Name
Immunity-related GTPase family M protein
UniProt Gene Name
IRGM
UniProt Synonym Gene Names
IFI1; IRGM1; LRG47; LRG-47
UniProt Entry Name
IRGM_HUMAN

NCBI Description

This gene encodes a member of the p47 immunity-related GTPase family. The encoded protein may play a role in the innate immune response by regulating autophagy formation in response to intracellular pathogens. Polymorphisms that affect the normal expression of this gene are associated with a susceptibility to Crohn's disease and tuberculosis.[provided by RefSeq, Oct 2010]

Uniprot Description

IRGM: Putative GTPase which is required for clearance of acute protozoan and bacterial infections. Functions in innate immune response probably through regulation of autophagy. May regulate proinflammatory cytokine production and prevent endotoxemia upon infection. May also play a role in macrophages adhesion and motility. Defects in IRGM are the cause of susceptibility to inflammatory bowel disease type 19 (IBD19). A chronic, relapsing inflammation of the gastrointestinal tract with a complex etiology. It is subdivided into Crohn disease and ulcerative colitis phenotypes. Crohn disease may affect any part of the gastrointestinal tract from the mouth to the anus, but most frequently it involves the terminal ileum and colon. Bowel inflammation is transmural and discontinuous; it may contain granulomas or be associated with intestinal or perianal fistulas. In contrast, in ulcerative colitis, the inflammation is continuous and limited to rectal and colonic mucosal layers; fistulas and granulomas are not observed. Both diseases include extraintestinal inflammation of the skin, eyes, or joints. Belongs to the interferon-inducible GTPase family.

Protein type: EC 3.6.5.-; Endoplasmic reticulum; Hydrolase

Chromosomal Location of Human Ortholog: 5q33.1

Disease: Inflammatory Bowel Disease 19; Mycobacterium Tuberculosis, Susceptibility To

Research Articles on IRGM

Similar Products

Product Notes

The IRGM irgm (Catalog #AAA1270601) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGAATGTTG AGAAAGCCTC AGCAGATGGG AACTTGCCAG AGGTGATCTC TAACATCAAG GAGACTCTGA AGATAGTGTC CAGGACACCA GTTAACATCA CTATGGCAGG GGACTCTGGC AATGGGATGT CCACCTTCAT CAGTGCCCTT CGAAACACAG GACATGAGGG TAAGGCCTCA CCTCCTACTG AGCTGGTAAA AGCTACCCAA AGATGTGCCT CCTATTTCTC TTCCCACTTT TCAAATGTGG TGTTGTGGGA CCTGCCTGGC ACAGGGTCTG CCACCACAAC CCTGGAGAAC TACCTGATGG AAATGCAGTT CAACCGGTAT GACTTCATCA TGGTTGCATC TGCACAATTC AGCATGAATC ATGTGATGCT TGCCAAAACC GCTGAGGACA TGGGAAAGAA GTTCTACATT GTCTGGACCA AGCTAGACAT GGACCTCAGC ACAGGTGCCC TCCCAGAAGT GCAGCTACTG CAGATCAGAG AAAATGTCCT GGAAAATCTC CAGAAGGAGC GGGTATGTGA ATACTAA. It is sometimes possible for the material contained within the vial of "IRGM, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.