Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

IRF5 cdna clone

IRF5 cDNA Clone

Gene Names
IRF5; SLEB10
Synonyms
IRF5; IRF5 cDNA Clone; IRF5 cdna clone
Ordering
For Research Use Only!
Sequence
atgaaccagtccatcccagtggctcccaccccaccccgccgcgtgcggctgaagccctggctggtggcccaggtgaacagctgccagtacccagggcttcaatgggtcaacggggaaaagaaattattctgcatcccctggaggcatgccacaaggcatggtcccagccaggacggagataacaccatcttcaaggcctgggccaaggagacagggaaatacaccgaaggcgtggatgaagccgatccggccaagtggaaggccaacctgcgctgtgcccttaacaagagccgggacttccgcctcatctacgacgggccccgggacatgccacctcagccctacaagatctacgaggtctgctccaatggccctgctcccacagactcccagccccctgaggattactcttttggtgcaggagaggaggaggaagaagaggaagagctgcagaggatgttgccaagcctgagcctcacagaggatgtcaagtggccgcccactctgcagccgcccactctgcggccgcctactctgcagccgcccactctgcagccgcccgtggtgctgggtccccctgctccagaccccagccccctggctcctccccctggcaaccctgctggcttcagggagcttctctctgaggtcctggagcctgggcccctgcctgccagcctgccccctgcaggcgaacagctcctgccagacctgctgatcagcccccacatgctgcctctgaccgacctggagatcaagtttcagtaccgggggcggccaccccgggccctcaccatcagcaacccccatggctgccggctcttctacagccagctggaggccacccaggagcaggtggaactcttcggccccataagcctggagcaagtgcgcttccccagccctgaggacatccccagtgacaagcagcgcttctacacgaaccagctgctggatgtcctggaccgcgggctcatcctccagctacagggccaggacctttatgccatccgcctgtgtcagtgcaaggtgttctggagcgggccttgtgcctcagcccatgactcatgccccaaccccatccagcgggaggtcaagaccaagcttttcagcctggagcattttctcaatgagctcatcctgttccaaaagggccagaccaacaccccaccacccttcgagatcttcttctgctttggggaagaatggcctgaccgcaaaccccgagagaagaagctcattactgtacaggtggtgcctgtagcagctcgactgctgctggagatgttctcaggggagctatcttggtcagctgatagtatccggctacagatctcaaacccagacctcaaagaccgcatggtggagcaattcaaggagctccatcacatctggcagtcccagcagcggttgcagcctgtggcccaggcccctcctggagcaggccttggtgttggccaggggccctggcctatgcacccagctggcatgcaataa
Sequence Length
1497
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
17,020 Da
NCBI Official Full Name
Homo sapiens interferon regulatory factor 5, mRNA
NCBI Official Synonym Full Names
interferon regulatory factor 5
NCBI Official Symbol
IRF5
NCBI Official Synonym Symbols
SLEB10
NCBI Protein Information
interferon regulatory factor 5
UniProt Protein Name
Interferon regulatory factor 5
UniProt Gene Name
IRF5
UniProt Synonym Gene Names
IRF-5
UniProt Entry Name
IRF5_HUMAN

NCBI Description

This gene encodes a member of the interferon regulatory factor (IRF) family, a group of transcription factors with diverse roles, including virus-mediated activation of interferon, and modulation of cell growth, differentiation, apoptosis, and immune system activity. Members of the IRF family are characterized by a conserved N-terminal DNA-binding domain containing tryptophan (W) repeats. Multiple transcript variants encoding different isoforms have been found for this gene, and a 30-nt indel polymorphism (SNP rs60344245) can result in loss of a 10-aa segment. [provided by RefSeq, Mar 2010]

Uniprot Description

IRF5: Transcription factor involved in the induction of interferons IFNA and INFB and inflammatory cytokines upon virus infection. Activated by TLR7 or TLR8 signaling. Homodimer, when phosphorylated. Belongs to the IRF family. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: Transcription factor; DNA-binding

Chromosomal Location of Human Ortholog: 7q32

Cellular Component: cytoplasm; cytosol; nucleus

Molecular Function: protein binding

Biological Process: positive regulation of apoptosis; positive regulation of interferon-alpha production; positive regulation of interferon-beta production; positive regulation of interleukin-12 production; positive regulation of transcription from RNA polymerase II promoter; response to muramyl dipeptide; response to peptidoglycan

Disease: Inflammatory Bowel Disease 14; Systemic Lupus Erythematosus, Susceptibility To, 10

Research Articles on IRF5

Similar Products

Product Notes

The IRF5 irf5 (Catalog #AAA1267722) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaccagt ccatcccagt ggctcccacc ccaccccgcc gcgtgcggct gaagccctgg ctggtggccc aggtgaacag ctgccagtac ccagggcttc aatgggtcaa cggggaaaag aaattattct gcatcccctg gaggcatgcc acaaggcatg gtcccagcca ggacggagat aacaccatct tcaaggcctg ggccaaggag acagggaaat acaccgaagg cgtggatgaa gccgatccgg ccaagtggaa ggccaacctg cgctgtgccc ttaacaagag ccgggacttc cgcctcatct acgacgggcc ccgggacatg ccacctcagc cctacaagat ctacgaggtc tgctccaatg gccctgctcc cacagactcc cagccccctg aggattactc ttttggtgca ggagaggagg aggaagaaga ggaagagctg cagaggatgt tgccaagcct gagcctcaca gaggatgtca agtggccgcc cactctgcag ccgcccactc tgcggccgcc tactctgcag ccgcccactc tgcagccgcc cgtggtgctg ggtccccctg ctccagaccc cagccccctg gctcctcccc ctggcaaccc tgctggcttc agggagcttc tctctgaggt cctggagcct gggcccctgc ctgccagcct gccccctgca ggcgaacagc tcctgccaga cctgctgatc agcccccaca tgctgcctct gaccgacctg gagatcaagt ttcagtaccg ggggcggcca ccccgggccc tcaccatcag caacccccat ggctgccggc tcttctacag ccagctggag gccacccagg agcaggtgga actcttcggc cccataagcc tggagcaagt gcgcttcccc agccctgagg acatccccag tgacaagcag cgcttctaca cgaaccagct gctggatgtc ctggaccgcg ggctcatcct ccagctacag ggccaggacc tttatgccat ccgcctgtgt cagtgcaagg tgttctggag cgggccttgt gcctcagccc atgactcatg ccccaacccc atccagcggg aggtcaagac caagcttttc agcctggagc attttctcaa tgagctcatc ctgttccaaa agggccagac caacacccca ccacccttcg agatcttctt ctgctttggg gaagaatggc ctgaccgcaa accccgagag aagaagctca ttactgtaca ggtggtgcct gtagcagctc gactgctgct ggagatgttc tcaggggagc tatcttggtc agctgatagt atccggctac agatctcaaa cccagacctc aaagaccgca tggtggagca attcaaggag ctccatcaca tctggcagtc ccagcagcgg ttgcagcctg tggcccaggc ccctcctgga gcaggccttg gtgttggcca ggggccctgg cctatgcacc cagctggcat gcaataa. It is sometimes possible for the material contained within the vial of "IRF5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.