Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

IRF3 cdna clone

IRF3 cDNA Clone

Gene Names
IRF3; IIAE7
Synonyms
IRF3; IRF3 cDNA Clone; IRF3 cdna clone
Ordering
For Research Use Only!
Sequence
atgggaaccccaaagccacggatcctgccctggctggtgtcgcagctggacctggggcaactggagggcgtggcctgggtgaacaagagccgcacgcgcttccgcatcccttggaagcacggcctacggcaggatgcacagcaggaggatttcggaatcttccaggcctgggccgaggccactggtgcatatgttcccgggagggataagccagacctgccaacctggaagaggaatttccgctctgccctcaaccgcaaagaagggttgcgtttagcagaggaccggagcaaggaccctcacgacccacataaaatctacgagtttgtgaactcaggagttggggacttttcccagccagacacctctccggacaccaatggtggaggcagtacttctgatacccaggaagacattctggatgagttactgggtaacatggtgttggccccactcccagatccgggacccccaagcctggctgtagcccctgagccctgccctcagcccctgcggagccccagcttggacaatcccactcccttcccaaacctggggccctctgagaacccactgaagcggctgttggtgccgggggaagagtgggagttcgaggtgacagccttctaccggggccgccaagtcttccagcagaccatctcctgcccggagggcctgcggctggtggggtccgaagtgggagacaggacgctgcctggatggccagtcacactgccagaccctggcatgtccctgacagacaggggagtgatgagctacgtgaggcatgtgctgagctgcctgggtgggggactggctctctggcgggccgggcagtggctctgggcccagcggctggggcactgccacacatactgggcagtgagcgaggagctgctccccaacagcgggcatgggcctgatggcgaggtccccaaggacaaggaaggaggcgtgtttgacctggggcccttcattgtaggctcctgggcccccagatctgattaccttcacggaaggaagcggacgctcaccacgctatgccctctggttctgtgtgggggagtcatggccccaggaccagccgtggaccaagaggctcgtgatggtcaaggttgtgcccacgtgcctcagggccttggtagaaatggcccgggtagggggtgcctcctccctggagaatactgtggacctgcacatttccaacagccacccactctccctcacctccgaccagtacaaggcctacctgcaggacttggtggagggcatggatttccagggccctggggagacctgagccctcgctcctcatggtgtgcctccaacccccctgttccccaccacctcaaccaataa
Sequence Length
1359
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
12,330 Da
NCBI Official Full Name
Homo sapiens interferon regulatory factor 3, mRNA
NCBI Official Synonym Full Names
interferon regulatory factor 3
NCBI Official Symbol
IRF3
NCBI Official Synonym Symbols
IIAE7
NCBI Protein Information
interferon regulatory factor 3
UniProt Protein Name
Interferon regulatory factor 3
UniProt Gene Name
IRF3
UniProt Synonym Gene Names
IRF-3
UniProt Entry Name
IRF3_HUMAN

NCBI Description

This gene encodes a member of the interferon regulatory transcription factor (IRF) family. The encoded protein is found in an inactive cytoplasmic form that upon serine/threonine phosphorylation forms a complex with CREBBP. This complex translocates to the nucleus and activates the transcription of interferons alpha and beta, as well as other interferon-induced genes. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]

Uniprot Description

IRF3: interferon regulatory factor 3, a member of the interferon regulatory transcription factor (IRF) family. IRF3 is found in an inactive cytoplasmic form that upon serine/threonine phosphorylation forms a complex with CREBBP. This complex translocates to the nucleus and activates the transcription of interferons alpha and beta, as well as other interferon-induced genes.

Protein type: Transcription factor; DNA-binding

Chromosomal Location of Human Ortholog: 19q13.3-q13.4

Cellular Component: cytoplasm; cytosol; nucleoplasm; nucleus

Molecular Function: identical protein binding; protein binding; protein homodimerization activity; transcription cofactor activity

Biological Process: apoptosis; defense response to virus; negative regulation of interferon type I production; positive regulation of interferon type I production; positive regulation of interferon-alpha production; positive regulation of interferon-beta production; response to DNA damage stimulus; transcription from RNA polymerase II promoter

Disease: Herpes Simplex Encephalitis, Susceptibility To, 7

Research Articles on IRF3

Similar Products

Product Notes

The IRF3 irf3 (Catalog #AAA1267612) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggaaccc caaagccacg gatcctgccc tggctggtgt cgcagctgga cctggggcaa ctggagggcg tggcctgggt gaacaagagc cgcacgcgct tccgcatccc ttggaagcac ggcctacggc aggatgcaca gcaggaggat ttcggaatct tccaggcctg ggccgaggcc actggtgcat atgttcccgg gagggataag ccagacctgc caacctggaa gaggaatttc cgctctgccc tcaaccgcaa agaagggttg cgtttagcag aggaccggag caaggaccct cacgacccac ataaaatcta cgagtttgtg aactcaggag ttggggactt ttcccagcca gacacctctc cggacaccaa tggtggaggc agtacttctg atacccagga agacattctg gatgagttac tgggtaacat ggtgttggcc ccactcccag atccgggacc cccaagcctg gctgtagccc ctgagccctg ccctcagccc ctgcggagcc ccagcttgga caatcccact cccttcccaa acctggggcc ctctgagaac ccactgaagc ggctgttggt gccgggggaa gagtgggagt tcgaggtgac agccttctac cggggccgcc aagtcttcca gcagaccatc tcctgcccgg agggcctgcg gctggtgggg tccgaagtgg gagacaggac gctgcctgga tggccagtca cactgccaga ccctggcatg tccctgacag acaggggagt gatgagctac gtgaggcatg tgctgagctg cctgggtggg ggactggctc tctggcgggc cgggcagtgg ctctgggccc agcggctggg gcactgccac acatactggg cagtgagcga ggagctgctc cccaacagcg ggcatgggcc tgatggcgag gtccccaagg acaaggaagg aggcgtgttt gacctggggc ccttcattgt aggctcctgg gcccccagat ctgattacct tcacggaagg aagcggacgc tcaccacgct atgccctctg gttctgtgtg ggggagtcat ggccccagga ccagccgtgg accaagaggc tcgtgatggt caaggttgtg cccacgtgcc tcagggcctt ggtagaaatg gcccgggtag ggggtgcctc ctccctggag aatactgtgg acctgcacat ttccaacagc cacccactct ccctcacctc cgaccagtac aaggcctacc tgcaggactt ggtggagggc atggatttcc agggccctgg ggagacctga gccctcgctc ctcatggtgt gcctccaacc cccctgttcc ccaccacctc aaccaataa. It is sometimes possible for the material contained within the vial of "IRF3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.