Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

IPMK cdna clone

IPMK cDNA Clone

Synonyms
IPMK; IPMK cDNA Clone; IPMK cdna clone
Ordering
For Research Use Only!
Sequence
atggcaacagagccaccatcccccctccgggtcgaggcgccgggccccccagaaatgcggacctcaccggcgatcgagtccacccctgagggcaccccgcagccggcgggcggcagactccgcttcctcaacggctgcgtgcccctctcgcatcaggtggccgggcacatgtacgggaaggacaaagtgggtatactgcaacatccagatggcacagttttgaaacagttacaaccacctccaaggggcccaagagagctggaattctataatatggtttatgctgctgactgttttgatggtgttcttctagagctacgaaaatatttgccaaaatattatggcatctggtcacctcccactgcaccaaacgatttatacctaaaactggaagatgtgacccataaatttaataagccctgtataatggatgtaaagatagggcaaaaaagctatgatccttttgcctcatctgagaagattcagcaacaggtcagcaagtacccattaatggaagagattgggttcttggtgcttggcatgagggtttatcatgttcattccgatagctatgagacagaaaaccagcattacggaagaagcttaacaaaagaaactataaaggatggagtctccagattttttcataatgggtactgcttaagaaaagatgctgttgctgccagtattcagaagattgagaaaattctgcagtggtttgaaaaccagaagcagcttaatttttacgcaagttcattactctttgtttatgaaggttcatctcagccaaccactacaaaattgaatgacagaactttggcagaaaagtttttgtccaaaggacaactgtcagacacagaagtactagagtacaataataactttcatgtgttaagttccacagctaatggaaaaatagagtcttcagtgggcaaaagcttgtccaagatgtatgcgcgtcacaggaaaatatatacaaaaaagcatcacagtcagacttcattgaaagttgaaaatctggagcaagacaatgggtggaaaagcatgtcacaggaacatttaaatggaaatgtactttcccaactggaaaaagttttctaccatcttcccactggttgccaagagattgctgaagtagaagtgcgaatgatagattttgctcatgtgttccctagcaacacaatagatgagggatatgtttatgggctaaagcatttaatttctgtacttcgaagtattttagacaattga
Sequence Length
1251
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
47,222 Da
NCBI Official Full Name
Homo sapiens inositol polyphosphate multikinase, mRNA
NCBI Official Synonym Full Names
inositol polyphosphate multikinase
NCBI Official Symbol
IPMK
NCBI Protein Information
inositol polyphosphate multikinase
UniProt Protein Name
Inositol polyphosphate multikinase
UniProt Gene Name
IPMK
UniProt Synonym Gene Names
IMPK
UniProt Entry Name
IPMK_HUMAN

NCBI Description

This gene encodes a member of the inositol phosphokinase family. The encoded protein has 3-kinase, 5-kinase and 6-kinase activities on phosphorylated inositol substrates. The encoded protein plays an important role in the biosynthesis of inositol 1,3,4,5,6-pentakisphosphate, and has a preferred 5-kinase activity. This gene may play a role in nuclear mRNA export. Pseudogenes of this gene are located on the long arm of chromosome 13 and the short arm of chromosome 19. [provided by RefSeq, Dec 2010]

Uniprot Description

IPMK: Inositol phosphate kinase with a broad substrate specificity. Has a preference for inositol 1,4,5-trisphosphate (Ins(1,4,5)P3) and inositol 1,3,4,6-tetrakisphosphate (Ins(1,3,4,6)P4). Belongs to the inositol phosphokinase (IPK) family.

Protein type: Motility/polarity/chemotaxis; EC 2.7.1.151; Kinase, other; Carbohydrate Metabolism - inositol phosphate

Chromosomal Location of Human Ortholog: 10q21.1

Cellular Component: nucleolus; nucleoplasm; nucleus

Molecular Function: inositol tetrakisphosphate 3-kinase activity; inositol tetrakisphosphate 5-kinase activity; inositol tetrakisphosphate 6-kinase activity; inositol trisphosphate 3-kinase activity

Biological Process: inositol phosphate metabolic process

Research Articles on IPMK

Similar Products

Product Notes

The IPMK ipmk (Catalog #AAA1270711) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcaacag agccaccatc ccccctccgg gtcgaggcgc cgggcccccc agaaatgcgg acctcaccgg cgatcgagtc cacccctgag ggcaccccgc agccggcggg cggcagactc cgcttcctca acggctgcgt gcccctctcg catcaggtgg ccgggcacat gtacgggaag gacaaagtgg gtatactgca acatccagat ggcacagttt tgaaacagtt acaaccacct ccaaggggcc caagagagct ggaattctat aatatggttt atgctgctga ctgttttgat ggtgttcttc tagagctacg aaaatatttg ccaaaatatt atggcatctg gtcacctccc actgcaccaa acgatttata cctaaaactg gaagatgtga cccataaatt taataagccc tgtataatgg atgtaaagat agggcaaaaa agctatgatc cttttgcctc atctgagaag attcagcaac aggtcagcaa gtacccatta atggaagaga ttgggttctt ggtgcttggc atgagggttt atcatgttca ttccgatagc tatgagacag aaaaccagca ttacggaaga agcttaacaa aagaaactat aaaggatgga gtctccagat tttttcataa tgggtactgc ttaagaaaag atgctgttgc tgccagtatt cagaagattg agaaaattct gcagtggttt gaaaaccaga agcagcttaa tttttacgca agttcattac tctttgttta tgaaggttca tctcagccaa ccactacaaa attgaatgac agaactttgg cagaaaagtt tttgtccaaa ggacaactgt cagacacaga agtactagag tacaataata actttcatgt gttaagttcc acagctaatg gaaaaataga gtcttcagtg ggcaaaagct tgtccaagat gtatgcgcgt cacaggaaaa tatatacaaa aaagcatcac agtcagactt cattgaaagt tgaaaatctg gagcaagaca atgggtggaa aagcatgtca caggaacatt taaatggaaa tgtactttcc caactggaaa aagttttcta ccatcttccc actggttgcc aagagattgc tgaagtagaa gtgcgaatga tagattttgc tcatgtgttc cctagcaaca caatagatga gggatatgtt tatgggctaa agcatttaat ttctgtactt cgaagtattt tagacaattg a. It is sometimes possible for the material contained within the vial of "IPMK, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.