Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

INPP1 cdna clone

INPP1 cDNA Clone

Synonyms
INPP1; INPP1 cDNA Clone; INPP1 cdna clone
Ordering
For Research Use Only!
Sequence
atgtcagatatcctccgggagctgctctgtgtctctgagaaggctgctaacattgcccgggcgtgcagacagcaggaagccctcttccagctgctgatcgaagaaaagaaagagggagaaaagaacaagaagtttgcagttgacttcaagacgctggctgatgtactggtacaggaagttataaaacagaatatggagaacaagtttccaggcttggaaaaaaatatttttggagaagaatccaatgagtttactaatgactggggggaaaagattaccttgaggttgtgttcaacagaggaggaaacagcagagcttcttagcaaagtcctcaatggtaacaaggtggcatctgaagcattagccagggttgttcatcaggatgttgcctttactgacccaactctggattccacagagatcaatgttccacaggacattttgggaatttgggtggaccccatagattcaacttatcagtatataaaaggttctgctgacattaaatccaaccagggaatcttcccctgtggacttcagtgtgtcaccattttaattggtgtctatgacatacagacaggggttcccctgatgggagtcatcaatcaaccttttgtgtcacgagatccaaacaccctcaggtggaaaggacagtgctattggggcctttcttacatggggaccaacatgcattcactacagctcaccatctctagaagaaacggcagtgaaacacacactggaaacaccggctctgaggcagcattctcccccagtttttcagccgtaattagtacaagtgaaaaggagactatcaaagctgcattgtcacgtgtgtgtggagatcgcatatttggggcagctggggctggttataagagcctatgtgttgtccaaggcctcgttgacatttacatcttttcagaagataccacattcaaatgggactcttgtgctgctcatgccatactgagggccatgggtgggggaatagtagacttgaaagaatgcttagaaagaaatccagaaacagggcttgatttgccacagttggtgtaccacgtggaaaatgagggtgctgctggggtggatcggtgggccaacaagggaggactcattgcatacagatccaggaagcggctggagacattcctgagcctcctggtccaaaacctggcacctgcagagacgcatacctag
Sequence Length
1200
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
43,998 Da
NCBI Official Full Name
Homo sapiens inositol polyphosphate-1-phosphatase, mRNA
NCBI Official Synonym Full Names
inositol polyphosphate-1-phosphatase
NCBI Official Symbol
INPP1
NCBI Protein Information
inositol polyphosphate 1-phosphatase
UniProt Protein Name
Inositol polyphosphate 1-phosphatase
UniProt Gene Name
INPP1
UniProt Synonym Gene Names
IPP; IPPase
UniProt Entry Name
INPP_HUMAN

NCBI Description

This gene encodes the enzyme inositol polyphosphate-1-phosphatase, one of the enzymes involved in phosphatidylinositol signaling pathways. This enzyme removes the phosphate group at position 1 of the inositol ring from the polyphosphates inositol 1,4-bisphosphate and inositol 1,3,4-trisphophosphate. [provided by RefSeq, Jul 2008]

Uniprot Description

INPP1: the enzyme inositol polyphosphate-1-phosphatase, one of the enzymes involved in phosphatidylinositol signaling pathways. This enzyme removes the phosphate group at position 1 of the inositol ring from the polyphosphates inositol 1,4-bisphosphate and inositol 1,3,4-trisphophosphate. [provided by RefSeq, Jul 2008]

Protein type: EC 3.1.3.57; Phosphatase (non-protein); Carbohydrate Metabolism - inositol phosphate; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 2q32

Cellular Component: cytoplasm; cytosol

Molecular Function: inositol-1,4-bisphosphate 1-phosphatase activity; magnesium ion binding

Biological Process: inositol phosphate dephosphorylation; inositol phosphate metabolic process; phosphate metabolic process; signal transduction

Research Articles on INPP1

Similar Products

Product Notes

The INPP1 inpp1 (Catalog #AAA1278960) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcagata tcctccggga gctgctctgt gtctctgaga aggctgctaa cattgcccgg gcgtgcagac agcaggaagc cctcttccag ctgctgatcg aagaaaagaa agagggagaa aagaacaaga agtttgcagt tgacttcaag acgctggctg atgtactggt acaggaagtt ataaaacaga atatggagaa caagtttcca ggcttggaaa aaaatatttt tggagaagaa tccaatgagt ttactaatga ctggggggaa aagattacct tgaggttgtg ttcaacagag gaggaaacag cagagcttct tagcaaagtc ctcaatggta acaaggtggc atctgaagca ttagccaggg ttgttcatca ggatgttgcc tttactgacc caactctgga ttccacagag atcaatgttc cacaggacat tttgggaatt tgggtggacc ccatagattc aacttatcag tatataaaag gttctgctga cattaaatcc aaccagggaa tcttcccctg tggacttcag tgtgtcacca ttttaattgg tgtctatgac atacagacag gggttcccct gatgggagtc atcaatcaac cttttgtgtc acgagatcca aacaccctca ggtggaaagg acagtgctat tggggccttt cttacatggg gaccaacatg cattcactac agctcaccat ctctagaaga aacggcagtg aaacacacac tggaaacacc ggctctgagg cagcattctc ccccagtttt tcagccgtaa ttagtacaag tgaaaaggag actatcaaag ctgcattgtc acgtgtgtgt ggagatcgca tatttggggc agctggggct ggttataaga gcctatgtgt tgtccaaggc ctcgttgaca tttacatctt ttcagaagat accacattca aatgggactc ttgtgctgct catgccatac tgagggccat gggtggggga atagtagact tgaaagaatg cttagaaaga aatccagaaa cagggcttga tttgccacag ttggtgtacc acgtggaaaa tgagggtgct gctggggtgg atcggtgggc caacaaggga ggactcattg catacagatc caggaagcgg ctggagacat tcctgagcct cctggtccaa aacctggcac ctgcagagac gcatacctag. It is sometimes possible for the material contained within the vial of "INPP1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.