Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

IMPA1 cdna clone

IMPA1 cDNA Clone

Gene Names
IMPA1; IMP; IMPA
Synonyms
IMPA1; IMPA1 cDNA Clone; IMPA1 cdna clone
Ordering
For Research Use Only!
Sequence
atggctgatccttggcaggaatgcatggattatgcagtaactctagcaagacaagctggagaggtagtttgtgaagctataaaaaatgaaatgaatgttatgctgaaaagttctccagttgatttggtaactgctacggaccaaaaagttgaaaaaatgcttatctcttccataaaggaaaagtatccatctcacagtttcattggtgaagaatctgtggcagctggggaaaaaagtatcttaaccgacaaccccacatggatcattgaccctattgatggaacaactaactttgtacatagatttccttttgtagctgtttcaattggctttgctgtaaataaaaagatagaatttggagttgtgtacagttgtgtggaaggcaagatgtacactgccagaaaaggaaaaggtgccttttgtaatggtcaaaaactacaagtctcacaacaagaagatattaccaaatctctcttggtgactgagttgggctcttccagaacaccagagactgtgagaatggttctttctaatatggaaaagcttttttgcattcctgttcatgggatccggagtgttggaacagcagctgttaatatgtgccttgtggcaactggcggagcagatgcatattatgaaatgggaattcactgctgggatgttgcaggagctggcattattgttactgaagctggtggcgtgctaatggatgttacaggtggaccatttgatttgatgtcacgaagagtaattgctgcaaataatagaatattagcagaaaggatagctaaagaaattcaggttatacctttgcaacgagacgacgaagattaa
Sequence Length
834
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
36,695 Da
NCBI Official Full Name
Homo sapiens inositol(myo)-1(or 4)-monophosphatase 1, mRNA
NCBI Official Synonym Full Names
inositol monophosphatase 1
NCBI Official Symbol
IMPA1
NCBI Official Synonym Symbols
IMP; IMPA
NCBI Protein Information
inositol monophosphatase 1
UniProt Protein Name
Inositol monophosphatase 1
Protein Family
UniProt Gene Name
IMPA1
UniProt Synonym Gene Names
IMPA; IMP 1; IMPase 1
UniProt Entry Name
IMPA1_HUMAN

NCBI Description

This gene encodes an enzyme that dephosphorylates myo-inositol monophosphate to generate free myo-inositol, a precursor of phosphatidylinositol, and is therefore an important modulator of intracellular signal transduction via the production of the second messengers myoinositol 1,4,5-trisphosphate and diacylglycerol. This enzyme can also use myo-inositol-1,3-diphosphate, myo-inositol-1,4-diphosphate, scyllo-inositol-phosphate, glucose-1-phosphate, glucose-6-phosphate, fructose-1-phosphate, beta-glycerophosphate, and 2'-AMP as substrates. This enzyme shows magnesium-dependent phosphatase activity and is inhibited by therapeutic concentrations of lithium. Inhibition of inositol monophosphate hydroylosis and subsequent depletion of inositol for phosphatidylinositol synthesis may explain the anti-manic and anti-depressive effects of lithium administered to treat bipolar disorder. Alternative splicing results in multiple transcript variants encoding distinct isoforms. A pseudogene of this gene is also present on chromosome 8q21.13. [provided by RefSeq, Dec 2014]

Uniprot Description

IMPA1: Responsible for the provision of inositol required for synthesis of phosphatidylinositol and polyphosphoinositides and has been implicated as the pharmacological target for lithium action in brain. Can use myo-inositol monophosphates, myo-inositol 1,3-diphosphate, myo-inositol 1,4-diphosphate, scyllo-inositol- phosphate, glucose-1-phosphate, glucose-6-phosphate, fructose-1- phosphate, beta-glycerophosphate, and 2'-AMP as substrates. Belongs to the inositol monophosphatase family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 3.1.3.94; Motility/polarity/chemotaxis; Phosphatase (non-protein); EC 3.1.3.25; Carbohydrate Metabolism - inositol phosphate

Chromosomal Location of Human Ortholog: 8q21.13-q21.3

Cellular Component: cytoplasm; cytosol

Molecular Function: identical protein binding; inositol-1(or 4)-monophosphatase activity; lithium ion binding; magnesium ion binding; manganese ion binding; protein binding; protein homodimerization activity

Biological Process: inositol metabolic process; inositol phosphate dephosphorylation; inositol phosphate metabolic process; phosphate metabolic process; phosphatidylinositol biosynthetic process; signal transduction

Research Articles on IMPA1

Similar Products

Product Notes

The IMPA1 impa1 (Catalog #AAA1267707) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctgatc cttggcagga atgcatggat tatgcagtaa ctctagcaag acaagctgga gaggtagttt gtgaagctat aaaaaatgaa atgaatgtta tgctgaaaag ttctccagtt gatttggtaa ctgctacgga ccaaaaagtt gaaaaaatgc ttatctcttc cataaaggaa aagtatccat ctcacagttt cattggtgaa gaatctgtgg cagctgggga aaaaagtatc ttaaccgaca accccacatg gatcattgac cctattgatg gaacaactaa ctttgtacat agatttcctt ttgtagctgt ttcaattggc tttgctgtaa ataaaaagat agaatttgga gttgtgtaca gttgtgtgga aggcaagatg tacactgcca gaaaaggaaa aggtgccttt tgtaatggtc aaaaactaca agtctcacaa caagaagata ttaccaaatc tctcttggtg actgagttgg gctcttccag aacaccagag actgtgagaa tggttctttc taatatggaa aagctttttt gcattcctgt tcatgggatc cggagtgttg gaacagcagc tgttaatatg tgccttgtgg caactggcgg agcagatgca tattatgaaa tgggaattca ctgctgggat gttgcaggag ctggcattat tgttactgaa gctggtggcg tgctaatgga tgttacaggt ggaccatttg atttgatgtc acgaagagta attgctgcaa ataatagaat attagcagaa aggatagcta aagaaattca ggttatacct ttgcaacgag acgacgaaga ttaa. It is sometimes possible for the material contained within the vial of "IMPA1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.