Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ILF2 cdna clone

ILF2 cDNA Clone

Gene Names
ILF2; NF45; PRO3063
Synonyms
ILF2; ILF2 cDNA Clone; ILF2 cdna clone
Ordering
For Research Use Only!
Sequence
atgaggggtgacagaggccgtggtcgtggtgggcgctttggttccagaggaggcccaggaggagggttcaggccctttgtaccacatatcccatttgacttctatttgtgtgaaatggcctttccccgggtcaagccagcacctgatgaaacttccttcagtgaggccttgctgaagaggaatcaggacctggctcccaattctgctgaacaggcatctatcctttctctggtgacaaaaataaacaatgtgattgataatctgattgtggctccagggacatttgaagtgcaaattgaagaagttcgacaggtgggatcctataaaaaggggacaatgactacaggacacaatgtggctgacctggtggtgatactcaagattctgccaacgttggaagctgttgctgccctggggaacaaagtcgtggaaagcctaagagcacaggatccttctgaagttttaaccatgctgaccaacgaaactggctttgaaatcagttcttctgatgctacagtgaagattctcattacaacagtgccacccaatcttcgaaaactggatccagaactccatttggatatcaaagtattgcagagtgccttagcagccatccgacatgcccgctggttcgaggaaaatgcttctcagtccacagttaaagttctcatcagactactgaaggacttgaggattcgttttcctggctttgagcccctcacaccctggatccttgacctactaggccattatgctgtgatgaacaaccccaccagacagcctttggccctaaacgttgcatacaggcgctgcttgcagattctggctgcaggactgttcctgccaggttcagtgggtatcactgacccctgtgagagtggcaactttagagtacacacagtcatgaccctagaacagcaggacatggtctgctatacagctcagactctcgtccgaatcctctcacatggtggctttaggaagatccttggccaggagggtgatgccagctatcttgcttctgaaatatctacctgggatggagtgatagtaacaccttcagaaaaggcttatgagaagccaccagagaagaaggaaggagaggaagaagaggagaatacagaagaaccacctcaaggagaggaagaagaaagcatggaaactcaggagtga
Sequence Length
1173
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
43,062 Da
NCBI Official Full Name
Homo sapiens interleukin enhancer binding factor 2, 45kDa, mRNA
NCBI Official Synonym Full Names
interleukin enhancer binding factor 2
NCBI Official Symbol
ILF2
NCBI Official Synonym Symbols
NF45; PRO3063
NCBI Protein Information
interleukin enhancer-binding factor 2
UniProt Protein Name
Interleukin enhancer-binding factor 2
UniProt Gene Name
ILF2
UniProt Synonym Gene Names
NF45
UniProt Entry Name
ILF2_HUMAN

NCBI Description

The protein encoded by this gene is a transcription factor required for T-cell expression of the interleukin 2 gene. It also binds RNA and is an essential component for encapsidation and protein priming of hepatitis B viral polymerase. The encoded 45 kDa protein (NF45, ILF2) forms a complex with the 90 kDa interleukin enhancer-binding factor 3 (NF90, ILF3), and this complex has been shown to affect the redistribution of nuclear mRNA to the cytoplasm, to repair DNA breaks by nonhomologous end joining, and to negatively regulate the microRNA processing pathway. Knockdown of NF45 or NF90 protein retards cell growth, possibly by inhibition of mRNA stabilization. Alternative splicing results in multiple transcript variants. Related pseudogenes have been found on chromosomes 3 and 14. [provided by RefSeq, Dec 2014]

Uniprot Description

ILF2: Appears to function predominantly as a heterodimeric complex with ILF3. This complex may regulate transcription of the IL2 gene during T-cell activation. It can also promote the formation of stable DNA-dependent protein kinase holoenzyme complexes on DNA.

Protein type: RNA-binding; Nucleolus; Transcription, coactivator/corepressor

Chromosomal Location of Human Ortholog: 1q21.3

Cellular Component: membrane; nucleolus; nucleoplasm; nucleus; ribonucleoprotein complex

Molecular Function: DNA binding; double-stranded RNA binding; protein binding

Biological Process: positive regulation of transcription, DNA-dependent; transcription, DNA-dependent

Research Articles on ILF2

Similar Products

Product Notes

The ILF2 ilf2 (Catalog #AAA1272080) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaggggtg acagaggccg tggtcgtggt gggcgctttg gttccagagg aggcccagga ggagggttca ggccctttgt accacatatc ccatttgact tctatttgtg tgaaatggcc tttccccggg tcaagccagc acctgatgaa acttccttca gtgaggcctt gctgaagagg aatcaggacc tggctcccaa ttctgctgaa caggcatcta tcctttctct ggtgacaaaa ataaacaatg tgattgataa tctgattgtg gctccaggga catttgaagt gcaaattgaa gaagttcgac aggtgggatc ctataaaaag gggacaatga ctacaggaca caatgtggct gacctggtgg tgatactcaa gattctgcca acgttggaag ctgttgctgc cctggggaac aaagtcgtgg aaagcctaag agcacaggat ccttctgaag ttttaaccat gctgaccaac gaaactggct ttgaaatcag ttcttctgat gctacagtga agattctcat tacaacagtg ccacccaatc ttcgaaaact ggatccagaa ctccatttgg atatcaaagt attgcagagt gccttagcag ccatccgaca tgcccgctgg ttcgaggaaa atgcttctca gtccacagtt aaagttctca tcagactact gaaggacttg aggattcgtt ttcctggctt tgagcccctc acaccctgga tccttgacct actaggccat tatgctgtga tgaacaaccc caccagacag cctttggccc taaacgttgc atacaggcgc tgcttgcaga ttctggctgc aggactgttc ctgccaggtt cagtgggtat cactgacccc tgtgagagtg gcaactttag agtacacaca gtcatgaccc tagaacagca ggacatggtc tgctatacag ctcagactct cgtccgaatc ctctcacatg gtggctttag gaagatcctt ggccaggagg gtgatgccag ctatcttgct tctgaaatat ctacctggga tggagtgata gtaacacctt cagaaaaggc ttatgagaag ccaccagaga agaaggaagg agaggaagaa gaggagaata cagaagaacc acctcaagga gaggaagaag aaagcatgga aactcaggag tga. It is sometimes possible for the material contained within the vial of "ILF2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.