Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

IL3 cdna clone

IL3 cDNA Clone

Gene Names
IL3; IL-3; MCGF; MULTI-CSF
Synonyms
IL3; IL3 cDNA Clone; IL3 cdna clone
Ordering
For Research Use Only!
Sequence
atgagccgcctgcccgtcctgctcctgctccaactcctggtccgccccggactccaagctcccatgacccagacaacgcccttgaagacaagctgggttaactgctctaacatgatcgatgaaattataacacacttaaagcagccacctttgcctttgctggacttcaacaacctcaatggggaagaccaagacattctgatggaaaataaccttcgaaggccaaacctggaggcattcaacagggctgtcaagagtttacagaacgcatcagcaattgagagcattcttaaaaatctcctgccatgtctgcccctggccacggccgcacccacgcgacatccaatccatatcaaggacggtgactggaatgaattccggaggaaactgacgttctatctgaaaacccttgagaatgcgcaggctcaacagacgactttgagcctcgcgatcttttga
Sequence Length
459
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
17,233 Da
NCBI Official Full Name
Homo sapiens interleukin 3 (colony-stimulating factor, multiple), mRNA
NCBI Official Synonym Full Names
interleukin 3
NCBI Official Symbol
IL3
NCBI Official Synonym Symbols
IL-3; MCGF; MULTI-CSF
NCBI Protein Information
interleukin-3
UniProt Protein Name
Interleukin-3
Protein Family
UniProt Gene Name
IL3
UniProt Synonym Gene Names
IL-3; MCGF
UniProt Entry Name
IL3_HUMAN

NCBI Description

The protein encoded by this gene is a potent growth promoting cytokine. This cytokine is capable of supporting the proliferation of a broad range of hematopoietic cell types. It is involved in a variety of cell activities such as cell growth, differentiation and apoptosis. This cytokine has been shown to also possess neurotrophic activity, and it may be associated with neurologic disorders. [provided by RefSeq, Jul 2008]

Uniprot Description

IL3: Granulocyte/macrophage colony-stimulating factors are cytokines that act in hematopoiesis by controlling the production, differentiation, and function of 2 related white cell populations of the blood, the granulocytes and the monocytes-macrophages. Belongs to the IL-3 family.

Protein type: Secreted, signal peptide; Secreted; Apoptosis; Cytokine; Cell cycle regulation; Oncoprotein

Chromosomal Location of Human Ortholog: 5q31.1

Cellular Component: extracellular region; extracellular space

Molecular Function: cytokine activity; interleukin-3 receptor binding; protein-tyrosine kinase activity; Ras guanyl-nucleotide exchange factor activity

Biological Process: cell-cell signaling; cytokine and chemokine mediated signaling pathway; embryonic hemopoiesis; MAPKKK cascade; nervous system development; positive regulation of cell proliferation; positive regulation of DNA replication; positive regulation of myeloid leukocyte differentiation; positive regulation of peptidyl-tyrosine phosphorylation; positive regulation of tyrosine phosphorylation of Stat5 protein

Research Articles on IL3

Similar Products

Product Notes

The IL3 il3 (Catalog #AAA1273791) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagccgcc tgcccgtcct gctcctgctc caactcctgg tccgccccgg actccaagct cccatgaccc agacaacgcc cttgaagaca agctgggtta actgctctaa catgatcgat gaaattataa cacacttaaa gcagccacct ttgcctttgc tggacttcaa caacctcaat ggggaagacc aagacattct gatggaaaat aaccttcgaa ggccaaacct ggaggcattc aacagggctg tcaagagttt acagaacgca tcagcaattg agagcattct taaaaatctc ctgccatgtc tgcccctggc cacggccgca cccacgcgac atccaatcca tatcaaggac ggtgactgga atgaattccg gaggaaactg acgttctatc tgaaaaccct tgagaatgcg caggctcaac agacgacttt gagcctcgcg atcttttga. It is sometimes possible for the material contained within the vial of "IL3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.