Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

IL25 cdna clone

IL25 cDNA Clone

Gene Names
IL25; IL17E
Synonyms
IL25; IL25 cDNA Clone; IL25 cdna clone
Ordering
For Research Use Only!
Sequence
atgagggagcgacccagattaggtgaggacagttctctcattagccttttcctacaggtggttgcattcttggcaatggtcatgggaacccacacctacagccactggcccagctgctgccccagcaaagggcaggacacctctgaggagctgctgaggtggagcactgtgcctgtgcctcccctagagcctgctaggcccaaccgccacccagagtcctgtagggccagtgaagatggacccctcaacagcagggccatctccccctggagatatgagttggacagagacttgaaccggctcccccaggacctgtaccacgcccgttgcctgtgcccgcactgcgtcagcctacagacaggctcccacatggacccccggggcaactcggagctgctctaccacaaccagactgtcttctacaggcggccatgccatggcgagaagggcacccacaagggctactgcctggagcgcaggctgtaccgtgtttccttagcttgtgtgtgtgtgcggccccgtgtgatgggctag
Sequence Length
534
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
18,523 Da
NCBI Official Full Name
Homo sapiens interleukin 25, mRNA
NCBI Official Synonym Full Names
interleukin 25
NCBI Official Symbol
IL25
NCBI Official Synonym Symbols
IL17E
NCBI Protein Information
interleukin-25
UniProt Protein Name
Interleukin-25
Protein Family
UniProt Gene Name
IL25
UniProt Synonym Gene Names
IL17E; IL-25; IL-17E
UniProt Entry Name
IL25_HUMAN

NCBI Description

The protein encoded by this gene is a cytokine that shares sequence similarity with interleukin 17. This cytokine can induce NF-kappaB activation, and stimulate the production of interleukin 8. Both this cytokine and interleukin 17B are ligands for the cytokine receptor IL17BR. Studies of a similar gene in mice suggest that this cytokine may be a pro-inflammatory cytokine favoring the Th2-type immune response. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010]

Uniprot Description

IL25: Induces activation of NF-kappa-B and stimulates production of the proinflammatory chemokine IL-8. Proinflammatory cytokine favoring Th2-type immune responses. Belongs to the IL-17 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Secreted; Secreted, signal peptide; Cytokine

Chromosomal Location of Human Ortholog: 14q11.2

Cellular Component: extracellular region; extracellular space

Molecular Function: cytokine activity; interleukin-17E receptor binding

Biological Process: cell surface receptor linked signal transduction; inflammatory response

Research Articles on IL25

Similar Products

Product Notes

The IL25 il25 (Catalog #AAA1273934) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagggagc gacccagatt aggtgaggac agttctctca ttagcctttt cctacaggtg gttgcattct tggcaatggt catgggaacc cacacctaca gccactggcc cagctgctgc cccagcaaag ggcaggacac ctctgaggag ctgctgaggt ggagcactgt gcctgtgcct cccctagagc ctgctaggcc caaccgccac ccagagtcct gtagggccag tgaagatgga cccctcaaca gcagggccat ctccccctgg agatatgagt tggacagaga cttgaaccgg ctcccccagg acctgtacca cgcccgttgc ctgtgcccgc actgcgtcag cctacagaca ggctcccaca tggacccccg gggcaactcg gagctgctct accacaacca gactgtcttc tacaggcggc catgccatgg cgagaagggc acccacaagg gctactgcct ggagcgcagg ctgtaccgtg tttccttagc ttgtgtgtgt gtgcggcccc gtgtgatggg ctag. It is sometimes possible for the material contained within the vial of "IL25, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.