Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

IL24 cdna clone

IL24 cDNA Clone

Gene Names
IL24; C49A; FISP; MDA7; MOB5; ST16; IL10B
Synonyms
IL24; IL24 cDNA Clone; IL24 cdna clone
Ordering
For Research Use Only!
Sequence
atgaattttcaacagaggctgcaaagcctgtggactttagccagcagacccttctgccctcctttgctggcgacagcctctcaaatgcagatggttgtgctcccttgcctgggttttaccctgcttctctggagccaggtatcaggggcccagggccaagaattccactttgggccctgccaagtgaagggggttgttccccagaaactgtgggaagccttctgggctgtgaaagacactatgcaagctcaggataacatcacgagtgcccggctgctgcagcaggaggttctgcagaacgtctcggatgctgagagctgttaccttgtccacaccctgctggagttctacttgaaaactgttttcaaaaactaccacaatagaacagttgaagtcaggactctgaagtcattctctactctggccaacaactttgttctcatcgtgtcacaactgcaacccagtcaagaaaatgagatgttttccatcagagacagtgcacacaggcggtttctgctattccggagagcattcaaacagttggacgtagaagcagctctgaccaaagcccttggggaagtggacattcttctgacctggatgcagaaattctacaagctctga
Sequence Length
624
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
7,347 Da
NCBI Official Full Name
Homo sapiens interleukin 24, mRNA
NCBI Official Synonym Full Names
interleukin 24
NCBI Official Symbol
IL24
NCBI Official Synonym Symbols
C49A; FISP; MDA7; MOB5; ST16; IL10B
NCBI Protein Information
interleukin-24
UniProt Protein Name
Interleukin-24
Protein Family
UniProt Gene Name
IL24
UniProt Synonym Gene Names
MDA7; ST16; IL-24; MDA-7
UniProt Entry Name
IL24_HUMAN

NCBI Description

This gene encodes a member of the IL10 family of cytokines. It was identified as a gene induced during terminal differentiation in melanoma cells. The protein encoded by this gene can induce apoptosis selectively in various cancer cells. Overexpression of this gene leads to elevated expression of several GADD family genes, which correlates with the induction of apoptosis. The phosphorylation of mitogen-activated protein kinase 14 (MAPK7/P38), and heat shock 27kDa protein 1 (HSPB2/HSP27) are found to be induced by this gene in melanoma cells, but not in normal immortal melanocytes. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]

Uniprot Description

IL24: Has antiproliferative properties on melanoma cells and may contribute to terminal cell differentiation. Belongs to the IL-10 family. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: Motility/polarity/chemotaxis; Secreted; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 1q32

Cellular Component: extracellular region; extracellular space

Molecular Function: cytokine activity; protein binding

Biological Process: immune response; inflammatory response; positive regulation of JAK-STAT cascade

Research Articles on IL24

Similar Products

Product Notes

The IL24 il24 (Catalog #AAA1270029) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaattttc aacagaggct gcaaagcctg tggactttag ccagcagacc cttctgccct cctttgctgg cgacagcctc tcaaatgcag atggttgtgc tcccttgcct gggttttacc ctgcttctct ggagccaggt atcaggggcc cagggccaag aattccactt tgggccctgc caagtgaagg gggttgttcc ccagaaactg tgggaagcct tctgggctgt gaaagacact atgcaagctc aggataacat cacgagtgcc cggctgctgc agcaggaggt tctgcagaac gtctcggatg ctgagagctg ttaccttgtc cacaccctgc tggagttcta cttgaaaact gttttcaaaa actaccacaa tagaacagtt gaagtcagga ctctgaagtc attctctact ctggccaaca actttgttct catcgtgtca caactgcaac ccagtcaaga aaatgagatg ttttccatca gagacagtgc acacaggcgg tttctgctat tccggagagc attcaaacag ttggacgtag aagcagctct gaccaaagcc cttggggaag tggacattct tctgacctgg atgcagaaat tctacaagct ctga. It is sometimes possible for the material contained within the vial of "IL24, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.