Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

IL17RC cdna clone

IL17RC cDNA Clone

Gene Names
IL17RC; CANDF9; IL17RL; IL17-RL
Synonyms
IL17RC; IL17RC cDNA Clone; IL17RC cdna clone
Ordering
For Research Use Only!
Sequence
atgcctgtgccctggttcttgctgtccttggcactgggccgaagcccagtggtcctttctctggagaggcttgtggggcctcaggacgctacccactgctctccgggcctctcctgccgcctctgggacagtgacatactctgcctgcctggggacatcgtgcctgctccgggccccgtgctggcgcctacgcacctgcagacagagctggtgctgaggtgccagaaggagaccgactgtgacctctgtctgcgtgtggctgtccacttggccgtgcatgggcactgggaagagcctgaagatgaggaaaagtttggaggagcagctgactcaggggtggaggagcctaggaatgcctctctccaggcccaagtcgtgctctccttccaggcctaccctactgcccgctgcgtcctgctggaggtgcaagtgcctgctgcccttgtgcagtttggtcagtctgtgggctctgtggtatatgactgcttcgaggctgccctagggagtgaggtacgaatctggtcctatactcagcccaggtacgagaaggaactcaaccacacacagcagctgcctgccctgccctggctcaacgtgtcagcagatggtgacaacgtgcatctggttctgaatgtctctgaggagcagcacttcggcctctccctgtactggaatcaggtccagggccccccaaaaccccggtggcacaaaaacctgactggaccgcagatcattaccttgaaccacacagacctggttccctgcctctgtattcaggtgtggcctctggaacctgactccgttaggacgaacatctgccccttcagggaggacccccgcgcacaccagaacctctggcaagccgcccgactgcgactgctgaccctgcagagctggctgctggacgcaccgtgctcgctgcccgcagaagcggcactgtgctggcgggctccgggtggggacccctgccagccactggtcccaccgctttcctgggagaacgtcactgtggacaaggttctcgagttcccattgctgaaaggccaccctaacctctgtgttcaggtgaacagctcggagaagctgcagctgcaggagtgcttgtgggctgactccctggggcctctcaaagacgatgtgctactgttggagacacgaggcccccaggacaacagatccctctgtgccttggaacccagtggctgtacttcactacccagcaaagcctccacgagggcagctcgccttggagagtacttactacaagacctgcagtcaggccagtgtctgcagctatgggacgatgacttgggagcgctatgggcctgccccatggacaaatacatccacaagcgctgggccctcgtgtggctggcctgcctactctttgccgctgcgctttccctcatcctccttctcaaaaaggatcacgcgaaagggtggctgaggctcttgaaacaggacgtccgctcggggggtgagtgggagcaagcgctgggcggagggccgcccccggggagccaggcctgtgccagctcacctcttccctccccatctgttttctccggcagcggccgccaggggccgcgcggctctgctcctctactcagccgatga
Sequence Length
1617
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
75,432 Da
NCBI Official Full Name
Homo sapiens interleukin 17 receptor C, mRNA
NCBI Official Synonym Full Names
interleukin 17 receptor C
NCBI Official Symbol
IL17RC
NCBI Official Synonym Symbols
CANDF9; IL17RL; IL17-RL
NCBI Protein Information
interleukin-17 receptor C
UniProt Protein Name
Interleukin-17 receptor C
Protein Family
UniProt Gene Name
IL17RC
UniProt Synonym Gene Names
IL-17 receptor C; IL-17RC; IL17Rhom; IL-17RL
UniProt Entry Name
I17RC_HUMAN

NCBI Description

This gene encodes a single-pass type I membrane protein that shares similarity with the interleukin-17 receptor (IL-17RA). Unlike IL-17RA, which is predominantly expressed in hemopoietic cells, and binds with high affinity to only IL-17A, this protein is expressed in nonhemopoietic tissues, and binds both IL-17A and IL-17F with similar affinities. The proinflammatory cytokines, IL-17A and IL-17F, have been implicated in the progression of inflammatory and autoimmune diseases. Multiple alternatively spliced transcript variants encoding different isoforms have been detected for this gene, and it has been proposed that soluble, secreted proteins lacking transmembrane and intracellular domains may function as extracellular antagonists to cytokine signaling. [provided by RefSeq, Feb 2011]

Uniprot Description

IL17RC: a single-pass type I membrane protein that shares similarity with the interleukin-17 receptor (IL-17RA). Unlike IL-17RA, which is predominantly expressed in hemopoietic cells, and binds with high affinity to only IL-17A, this protein is expressed in nonhemopoietic tissues, and binds both IL-17A and IL-17F with similar affinities. The proinflammatory cytokines, IL-17A and IL-17F, have been implicated in the progression of inflammatory and autoimmune diseases. Multiple alternatively spliced transcript variants encoding different isoforms have been detected for this gene, and it has been proposed that soluble, secreted proteins lacking transmembrane and intracellular domains may function as extracellular antagonists to cytokine signaling. [provided by RefSeq, Feb 2011]

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 3p25.3|3p25.3-p24.1

Cellular Component: integral to plasma membrane; plasma membrane

Molecular Function: interleukin-17 receptor activity

Disease: Candidiasis, Familial, 9

Research Articles on IL17RC

Similar Products

Product Notes

The IL17RC il17rc (Catalog #AAA1276995) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcctgtgc cctggttctt gctgtccttg gcactgggcc gaagcccagt ggtcctttct ctggagaggc ttgtggggcc tcaggacgct acccactgct ctccgggcct ctcctgccgc ctctgggaca gtgacatact ctgcctgcct ggggacatcg tgcctgctcc gggccccgtg ctggcgccta cgcacctgca gacagagctg gtgctgaggt gccagaagga gaccgactgt gacctctgtc tgcgtgtggc tgtccacttg gccgtgcatg ggcactggga agagcctgaa gatgaggaaa agtttggagg agcagctgac tcaggggtgg aggagcctag gaatgcctct ctccaggccc aagtcgtgct ctccttccag gcctacccta ctgcccgctg cgtcctgctg gaggtgcaag tgcctgctgc ccttgtgcag tttggtcagt ctgtgggctc tgtggtatat gactgcttcg aggctgccct agggagtgag gtacgaatct ggtcctatac tcagcccagg tacgagaagg aactcaacca cacacagcag ctgcctgccc tgccctggct caacgtgtca gcagatggtg acaacgtgca tctggttctg aatgtctctg aggagcagca cttcggcctc tccctgtact ggaatcaggt ccagggcccc ccaaaacccc ggtggcacaa aaacctgact ggaccgcaga tcattacctt gaaccacaca gacctggttc cctgcctctg tattcaggtg tggcctctgg aacctgactc cgttaggacg aacatctgcc ccttcaggga ggacccccgc gcacaccaga acctctggca agccgcccga ctgcgactgc tgaccctgca gagctggctg ctggacgcac cgtgctcgct gcccgcagaa gcggcactgt gctggcgggc tccgggtggg gacccctgcc agccactggt cccaccgctt tcctgggaga acgtcactgt ggacaaggtt ctcgagttcc cattgctgaa aggccaccct aacctctgtg ttcaggtgaa cagctcggag aagctgcagc tgcaggagtg cttgtgggct gactccctgg ggcctctcaa agacgatgtg ctactgttgg agacacgagg cccccaggac aacagatccc tctgtgcctt ggaacccagt ggctgtactt cactacccag caaagcctcc acgagggcag ctcgccttgg agagtactta ctacaagacc tgcagtcagg ccagtgtctg cagctatggg acgatgactt gggagcgcta tgggcctgcc ccatggacaa atacatccac aagcgctggg ccctcgtgtg gctggcctgc ctactctttg ccgctgcgct ttccctcatc ctccttctca aaaaggatca cgcgaaaggg tggctgaggc tcttgaaaca ggacgtccgc tcggggggtg agtgggagca agcgctgggc ggagggccgc ccccggggag ccaggcctgt gccagctcac ctcttccctc cccatctgtt ttctccggca gcggccgcca ggggccgcgc ggctctgctc ctctactcag ccgatga. It is sometimes possible for the material contained within the vial of "IL17RC, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.