Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

IL13RA2 cdna clone

IL13RA2 cDNA Clone

Gene Names
IL13RA2; CT19; IL-13R; IL13BP; CD213A2
Synonyms
IL13RA2; IL13RA2 cDNA Clone; IL13RA2 cdna clone
Ordering
For Research Use Only!
Sequence
atggctttcgtttgcttggctatcggatgcttatatacctttctgataagcacaacatttggctgtacttcatcttcagacaccgagataaaagttaaccctcctcaggattttgagatagtggatcccggatacttaggttatctctatttgcaatggcaacccccactgtctctggatcattttaaggaatgcacagtggaatatgaactaaaataccgaaacattggtagtgaaacatggaagaccatcattactaagaatctacattacaaagatgggtttgatcttaacaagggcattgaagcgaagatacacacgcttttaccatggcaatgcacaaatggatcagaagttcaaagttcctgggcagaaactacttattggatatcaccacaaggaattccagaaactaaagttcaggatatggattgcgtatattacaattggcaatatttactctgttcttggaaacctggcataggtgtacttcttgataccaattacaacttgttttactggtatgagggcttggatcatgcattacagtgtgttgattacatcaaggctgatggacaaaatataggatgcagatttccctatttggaggcatcagactataaagatttctatatttgtgttaatggatcatcagagaacaagcctatcagatccagttatttcacttttcagcttcaaaatatagttaaacctttgccgccagtctatcttacttttactcgggagagttcatgtgaaattaagctgaaatggagcatacctttgggacctattccagcaaggtgttttgattatgaaattgagatcagagaagatgatactaccttggtgactgctacagttgaaaatgaaacatacaccttgaaaacaacaaatgaaacccgacaattatgctttgtagtaagaagcaaagtgaatatttattgctcagatgacggaatttggagtgagtggagtgataaacaatgctgggaaggtgaagacctatcgaagaaaactttgctacgtttctggctaccatttggtttcatcttaatattagttatatttgtaaccggtctgcttttgcgtaagccaaacacctacccaaaaatgattccagaatttttctgtgatacatga
Sequence Length
1143
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
44,176 Da
NCBI Official Full Name
Homo sapiens interleukin 13 receptor, alpha 2, mRNA
NCBI Official Synonym Full Names
interleukin 13 receptor subunit alpha 2
NCBI Official Symbol
IL13RA2
NCBI Official Synonym Symbols
CT19; IL-13R; IL13BP; CD213A2
NCBI Protein Information
interleukin-13 receptor subunit alpha-2
UniProt Protein Name
Interleukin-13 receptor subunit alpha-2
Protein Family
UniProt Gene Name
IL13RA2
UniProt Synonym Gene Names
IL13R; IL-13 receptor subunit alpha-2; IL-13R subunit alpha-2; IL-13R-alpha-2; IL-13RA2
UniProt Entry Name
I13R2_HUMAN

NCBI Description

The protein encoded by this gene is closely related to Il13RA1, a subuint of the interleukin 13 receptor complex. This protein binds IL13 with high affinity, but lacks cytoplasmic domain, and does not appear to function as a signal mediator. It is reported to play a role in the internalization of IL13. [provided by RefSeq, Jul 2008]

Uniprot Description

IL13RA2: a type I membrane protein that binds with high affinity to interleukin-13 (IL13), but not to interleukin-4 (IL4). Lacks a cytoplasmic domain, and does not appear to function as a signal mediator. It is reported to play a role in the internalization of IL13. A member of the Cancer-Testis Antigen (CTA) superfamily. CTAs may play roles in embryonal development and tumor transformation or aspects of tumor progression. CTAs were once thought to be silenced in most normal adult tissues, with limited expression in fetal, placental, testis, and ovarian cells. These proteins are now known to be aberrantly expressed in various cancers and many are capable of eliciting humoral and cellular immune responses. The WSXWS motif appears to be necessary for proper protein folding and thereby efficient intracellular transport and cell-surface receptor binding. The box 1 motif is required for JAK interaction and/or activation. Often overexpressed in brain tumors. A potential vaccine targets for immunotherapy of glioma. Note: This description may include information from RefSeq and UniProtKB

Protein type: Receptor, cytokine; Cancer Testis Antigen (CTA); Membrane protein, integral

Chromosomal Location of Human Ortholog: Xq23

Cellular Component: extracellular region; extracellular space

Molecular Function: hematopoietin/interferon-class (D200-domain) cytokine receptor activity; signal transducer activity

Research Articles on IL13RA2

Similar Products

Product Notes

The IL13RA2 il13ra2 (Catalog #AAA1268984) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctttcg tttgcttggc tatcggatgc ttatatacct ttctgataag cacaacattt ggctgtactt catcttcaga caccgagata aaagttaacc ctcctcagga ttttgagata gtggatcccg gatacttagg ttatctctat ttgcaatggc aacccccact gtctctggat cattttaagg aatgcacagt ggaatatgaa ctaaaatacc gaaacattgg tagtgaaaca tggaagacca tcattactaa gaatctacat tacaaagatg ggtttgatct taacaagggc attgaagcga agatacacac gcttttacca tggcaatgca caaatggatc agaagttcaa agttcctggg cagaaactac ttattggata tcaccacaag gaattccaga aactaaagtt caggatatgg attgcgtata ttacaattgg caatatttac tctgttcttg gaaacctggc ataggtgtac ttcttgatac caattacaac ttgttttact ggtatgaggg cttggatcat gcattacagt gtgttgatta catcaaggct gatggacaaa atataggatg cagatttccc tatttggagg catcagacta taaagatttc tatatttgtg ttaatggatc atcagagaac aagcctatca gatccagtta tttcactttt cagcttcaaa atatagttaa acctttgccg ccagtctatc ttacttttac tcgggagagt tcatgtgaaa ttaagctgaa atggagcata cctttgggac ctattccagc aaggtgtttt gattatgaaa ttgagatcag agaagatgat actaccttgg tgactgctac agttgaaaat gaaacataca ccttgaaaac aacaaatgaa acccgacaat tatgctttgt agtaagaagc aaagtgaata tttattgctc agatgacgga atttggagtg agtggagtga taaacaatgc tgggaaggtg aagacctatc gaagaaaact ttgctacgtt tctggctacc atttggtttc atcttaatat tagttatatt tgtaaccggt ctgcttttgc gtaagccaaa cacctaccca aaaatgattc cagaattttt ctgtgataca tga. It is sometimes possible for the material contained within the vial of "IL13RA2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.