Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

IL10RA cdna clone

IL10RA cDNA Clone

Gene Names
IL10RA; CD210; IL10R; CD210a; CDW210A; HIL-10R; IL-10R1
Synonyms
IL10RA; IL10RA cDNA Clone; IL10RA cdna clone
Ordering
For Research Use Only!
Sequence
atgctgccgtgcctcgtagtgctgctggcggcgctcctcagcctccgtcttggctcagacgctcatgggacagagctgcccagccctccgtctgtgtggtttgaagcagaatttttccaccacatcctccactggacacccatcccaaatcagtctgaaagtacctgctatgaagtggcactcctgaggtatggaatagagtcctggaactccatctccaactgtagccagaccctgtcctatgaccttaccgcagtgaccttggacctgtaccacagcaatggctaccgggccagagtgcgggctgtggacggcagccggcactccaactggaccgtcaccaacacccgcttctctgtggatgaagtgactctgacagttggcagtgtgaacctagagatccacaatggcttcatcctcgggaagattcagctacccaggcccaagatggcccccgcaaatgacacatatgaaagcatcttcagtcacttccgagagtatgagattgccattcgcaaggtgccgggaaacttcacgttcacacacaagaaagtaaaacatgaaaacttcagcctcctaacctctggagaagtgggagagttctgtgtccaggtgaaaccatctgtcgcttcccgaagtaacaaggggatgtggtctaaagaggagtgcatctccctcaccaggcagtatttcaccgtgaccaacgtcatcatcttctttgcctttgtcctgctgctctccggagccctcgcctactgcctggccctccagctgtatgtgcggcgccgaaagaagctacccagtgtcctgctcttcaagaagcccagccccttcatcttcatcagccagcgtccctccccagagacccaagacaccatccacccgcttgatgaggaggcctttttgaaggtgtccccagagctgaagaacttggacctgcacggcagcacagacagtggctttggcagcaccaagccatccctgcagactgaagagccccagttcctcctccctgaccctcacccccaggctgacagaacgctgggaaacggggagccccctgtgctgggggacagctgcagtagtggcagcagcaatagcacagacagcgggatctgcctgcaggagcccagcctgagccccagcacagggcccacctgggagcaacaggtggggagcaacagcaggggccaggatgacagtggcattgacttagttcaaaactctgagggccgggctggggacacacagggtggctcggccttgggccaccacagtcccccggagcctgaggtgcctggggaagaagacccagctgctgtggcattccagggttacctgaggcagaccagatgtgctgaagagaaggcaaccaagacaggctgcctggaggaagaatcgcccttgacagatggccttggccccaaattcgggagatgcctggttgatgaggcaggcttgcatccaccagccctggccaagggctatttgaaacaggatcctctagaaatgactctggcttcctcaggggccccaacgggacagtggaaccagcccactgaggaatggtcactcctggccttgagcagctgcagtgacctgggaatatctgactggagctttgcccatgaccttgcccctctaggctgtgtggcagccccaggtggtctcctgggcagctttaactcagacctggtcaccctgcccctcatctctagcctgcagtcaagtgagtga
Sequence Length
1737
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
63,003 Da
NCBI Official Full Name
Homo sapiens interleukin 10 receptor, alpha, mRNA
NCBI Official Synonym Full Names
interleukin 10 receptor subunit alpha
NCBI Official Symbol
IL10RA
NCBI Official Synonym Symbols
CD210; IL10R; CD210a; CDW210A; HIL-10R; IL-10R1
NCBI Protein Information
interleukin-10 receptor subunit alpha
UniProt Protein Name
Interleukin-10 receptor subunit alpha
Protein Family
UniProt Gene Name
IL10RA
UniProt Synonym Gene Names
IL10R; IL-10 receptor subunit alpha; IL-10R subunit alpha; IL-10RA; IL-10R subunit 1; IL-10R1
UniProt Entry Name
I10R1_HUMAN

NCBI Description

The protein encoded by this gene is a receptor for interleukin 10. This protein is structurally related to interferon receptors. It has been shown to mediate the immunosuppressive signal of interleukin 10, and thus inhibits the synthesis of proinflammatory cytokines. This receptor is reported to promote survival of progenitor myeloid cells through the insulin receptor substrate-2/PI 3-kinase/AKT pathway. Activation of this receptor leads to tyrosine phosphorylation of JAK1 and TYK2 kinases. Two transcript variants, one protein-coding and the other not protein-coding, have been found for this gene. [provided by RefSeq, Jan 2009]

Uniprot Description

IL10RA: a receptor for interleukin 10 structurally related to interferon receptors. Mediates the immunosuppressive signal of interleukin 10, and thus inhibits the synthesis of proinflammatory cytokines. This receptor is reported to promote survival of progenitor myeloid cells through the insulin receptor substrate-2/PI 3-kinase/AKT pathway. Activation of this receptor leads to tyrosine phosphorylation of JAK1 and TYK2 kinases.

Protein type: Membrane protein, integral; Receptor, cytokine

Chromosomal Location of Human Ortholog: 11q23

Cellular Component: integral to membrane

Molecular Function: protein binding; receptor activity; signal transducer activity

Disease: Inflammatory Bowel Disease 28, Autosomal Recessive

Research Articles on IL10RA

Similar Products

Product Notes

The IL10RA il10ra (Catalog #AAA1267945) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgccgt gcctcgtagt gctgctggcg gcgctcctca gcctccgtct tggctcagac gctcatggga cagagctgcc cagccctccg tctgtgtggt ttgaagcaga atttttccac cacatcctcc actggacacc catcccaaat cagtctgaaa gtacctgcta tgaagtggca ctcctgaggt atggaataga gtcctggaac tccatctcca actgtagcca gaccctgtcc tatgacctta ccgcagtgac cttggacctg taccacagca atggctaccg ggccagagtg cgggctgtgg acggcagccg gcactccaac tggaccgtca ccaacacccg cttctctgtg gatgaagtga ctctgacagt tggcagtgtg aacctagaga tccacaatgg cttcatcctc gggaagattc agctacccag gcccaagatg gcccccgcaa atgacacata tgaaagcatc ttcagtcact tccgagagta tgagattgcc attcgcaagg tgccgggaaa cttcacgttc acacacaaga aagtaaaaca tgaaaacttc agcctcctaa cctctggaga agtgggagag ttctgtgtcc aggtgaaacc atctgtcgct tcccgaagta acaaggggat gtggtctaaa gaggagtgca tctccctcac caggcagtat ttcaccgtga ccaacgtcat catcttcttt gcctttgtcc tgctgctctc cggagccctc gcctactgcc tggccctcca gctgtatgtg cggcgccgaa agaagctacc cagtgtcctg ctcttcaaga agcccagccc cttcatcttc atcagccagc gtccctcccc agagacccaa gacaccatcc acccgcttga tgaggaggcc tttttgaagg tgtccccaga gctgaagaac ttggacctgc acggcagcac agacagtggc tttggcagca ccaagccatc cctgcagact gaagagcccc agttcctcct ccctgaccct cacccccagg ctgacagaac gctgggaaac ggggagcccc ctgtgctggg ggacagctgc agtagtggca gcagcaatag cacagacagc gggatctgcc tgcaggagcc cagcctgagc cccagcacag ggcccacctg ggagcaacag gtggggagca acagcagggg ccaggatgac agtggcattg acttagttca aaactctgag ggccgggctg gggacacaca gggtggctcg gccttgggcc accacagtcc cccggagcct gaggtgcctg gggaagaaga cccagctgct gtggcattcc agggttacct gaggcagacc agatgtgctg aagagaaggc aaccaagaca ggctgcctgg aggaagaatc gcccttgaca gatggccttg gccccaaatt cgggagatgc ctggttgatg aggcaggctt gcatccacca gccctggcca agggctattt gaaacaggat cctctagaaa tgactctggc ttcctcaggg gccccaacgg gacagtggaa ccagcccact gaggaatggt cactcctggc cttgagcagc tgcagtgacc tgggaatatc tgactggagc tttgcccatg accttgcccc tctaggctgt gtggcagccc caggtggtct cctgggcagc tttaactcag acctggtcac cctgcccctc atctctagcc tgcagtcaag tgagtga. It is sometimes possible for the material contained within the vial of "IL10RA, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.