Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

IKZF2 cdna clone

IKZF2 cDNA Clone

Gene Names
IKZF2; ANF1A2; HELIOS; ZNF1A2; ZNFN1A2
Synonyms
IKZF2; IKZF2 cDNA Clone; IKZF2 cdna clone
Ordering
For Research Use Only!
Sequence
atggaaacagaggctattgatggctatataacgtgtgacaatgagctttcacccgaaagggagcactccaatatggcaattgacctcacctcaagcacacccaatggacagcatgcctcaccaagtcacatgacaagcacaaattcagtaaagctagaaatgcagagtgatgaagagtgtgacaggaaacccctgagccgtgaagatgagatcaggggccatgatgagggtagcagcctagaagaacccctaattgagagcagcgaggtggctgacaacaggaaagtccaggagcttcaaggcgagggaggaatccggcttccgaatggtgaacgccccttccactgtaaccagtgtggagcttcttttactcagaagggcaaccttctgagacacataaagttacactctggagagaagccgttcaaatgtcctttctgtagctacgcctgtagaagaagggacgccctcacaggacacctcaggacccattctgtgggtaaacctcacaagtgcaactactgtggacgaagctacaagcagcgcagttcactggaggagcacaaggaacgctgccacaactatctccagaatgtcagcatggaggctgctgggcaggtcatgagtcaccatgtacctcctatggaagattgtaaggaacaagagcctattatggacaacaatatttctctggtgccttttgagagacctgctgtcatagagaagctcacggggaatatgggaaaacgtaaaagctccactccacaaaagtttgtgggggaaaagctcatgcgattcagctacccagatattcactttgatatgaacttaacatatgagaaggaggctgagctgatgcagtctcatatgatggaccaagccatcaacaatgcaatcacctaccttggagctgaggcccttcaccctctgatgcagcacccgccaagcacaatcgctgaagtggccccagttataagctcagcttattctcaggtctatcatccaaataggatagaaagacccattagcagggaaactgctgatagtcatgaaaacaacatggatggccccatctctctcatcagaccaaagagtcgaccccaggaaagagaggcctctcccagcaatagctgcctggattccactgactcagaaagcagccatgatgaccaccagtcctaccaaggacaccctgccttaaatcccaagaggaaacaaagcccagcttacatgaaggaggatgtcaaagctttggatactaccaaggctcctaagggctctctgaaggacatctacaaggtcttcaatggagaaggagaacagattagggccttcaagtgtgagcactgccgagtccttttcctagaccatgtcatgtacaccattcacatgggttgccatggctaccgggacccactggaatgcaacatctgtggctacagaagccaggaccgttatgagttttcatcacacattgttcgaggggagcacacattccactag
Sequence Length
1503
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
25,979 Da
NCBI Official Full Name
Homo sapiens IKAROS family zinc finger 2 (Helios), mRNA
NCBI Official Synonym Full Names
IKAROS family zinc finger 2
NCBI Official Symbol
IKZF2
NCBI Official Synonym Symbols
ANF1A2; HELIOS; ZNF1A2; ZNFN1A2
NCBI Protein Information
zinc finger protein Helios
UniProt Protein Name
Zinc finger protein Helios
Protein Family
UniProt Gene Name
IKZF2
UniProt Synonym Gene Names
HELIOS; ZNFN1A2
UniProt Entry Name
IKZF2_HUMAN

NCBI Description

This gene encodes a member of the Ikaros family of zinc-finger proteins. Three members of this protein family (Ikaros, Aiolos and Helios) are hematopoietic-specific transcription factors involved in the regulation of lymphocyte development. This protein forms homo- or hetero-dimers with other Ikaros family members, and is thought to function predominantly in early hematopoietic development. Multiple transcript variants encoding different isoforms have been found for this gene, but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]

Uniprot Description

Associates with Ikaros at centromeric heterochromatin.

Research Articles on IKZF2

Similar Products

Product Notes

The IKZF2 ikzf2 (Catalog #AAA1269861) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaaacag aggctattga tggctatata acgtgtgaca atgagctttc acccgaaagg gagcactcca atatggcaat tgacctcacc tcaagcacac ccaatggaca gcatgcctca ccaagtcaca tgacaagcac aaattcagta aagctagaaa tgcagagtga tgaagagtgt gacaggaaac ccctgagccg tgaagatgag atcaggggcc atgatgaggg tagcagccta gaagaacccc taattgagag cagcgaggtg gctgacaaca ggaaagtcca ggagcttcaa ggcgagggag gaatccggct tccgaatggt gaacgcccct tccactgtaa ccagtgtgga gcttctttta ctcagaaggg caaccttctg agacacataa agttacactc tggagagaag ccgttcaaat gtcctttctg tagctacgcc tgtagaagaa gggacgccct cacaggacac ctcaggaccc attctgtggg taaacctcac aagtgcaact actgtggacg aagctacaag cagcgcagtt cactggagga gcacaaggaa cgctgccaca actatctcca gaatgtcagc atggaggctg ctgggcaggt catgagtcac catgtacctc ctatggaaga ttgtaaggaa caagagccta ttatggacaa caatatttct ctggtgcctt ttgagagacc tgctgtcata gagaagctca cggggaatat gggaaaacgt aaaagctcca ctccacaaaa gtttgtgggg gaaaagctca tgcgattcag ctacccagat attcactttg atatgaactt aacatatgag aaggaggctg agctgatgca gtctcatatg atggaccaag ccatcaacaa tgcaatcacc taccttggag ctgaggccct tcaccctctg atgcagcacc cgccaagcac aatcgctgaa gtggccccag ttataagctc agcttattct caggtctatc atccaaatag gatagaaaga cccattagca gggaaactgc tgatagtcat gaaaacaaca tggatggccc catctctctc atcagaccaa agagtcgacc ccaggaaaga gaggcctctc ccagcaatag ctgcctggat tccactgact cagaaagcag ccatgatgac caccagtcct accaaggaca ccctgcctta aatcccaaga ggaaacaaag cccagcttac atgaaggagg atgtcaaagc tttggatact accaaggctc ctaagggctc tctgaaggac atctacaagg tcttcaatgg agaaggagaa cagattaggg ccttcaagtg tgagcactgc cgagtccttt tcctagacca tgtcatgtac accattcaca tgggttgcca tggctaccgg gacccactgg aatgcaacat ctgtggctac agaagccagg accgttatga gttttcatca cacattgttc gaggggagca cacattccac tag. It is sometimes possible for the material contained within the vial of "IKZF2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.