Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

IGLL1 cdna clone

IGLL1 cDNA Clone

Gene Names
IGLL1; IGO; 14.1; AGM2; IGL1; IGL5; IGLL; IGVPB; CD179b; VPREB2; IGLJ14.1
Synonyms
IGLL1; IGLL1 cDNA Clone; IGLL1 cdna clone
Ordering
For Research Use Only!
Sequence
atgaggccagggacaggccaggggggccttgaggcccctggtgagccaggccccaacctcaggcagcgctggcccctgctgctgctgggtctggccgtggtaacccatggcctgctgcgcccaacagctgcatcgcagagcagggccctgggccctggagcccctggaggaagcagccggtccagcctgaggagccggtggggcaggttcctgctccagcgcggctcctggactggccccaggtgctggccccgggggtttcaatccaagcataactcagtgacgcatgtgtttggcagcgggacccagctcaccgttttaagtcagcccaaggccaccccctcggtcactctgttcccgccgtcctctgaggagctccaagccaacaaggctacactggtgtgtctcatgaatgacttttatccgggaatcttgacggtgacctggaaggcagatggtacccccatcacccagggcgtggagatgaccacgccctccaaacagagcaacaacaagtacgcggccagcagctacctgagcctgacgcccgagcagtggaggtcccgcagaagctacagctgccaggtcatgcacgaagggagcaccgtggagaagacggtggcccctgcagaatgttcatag
Sequence Length
642
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
8,574 Da
NCBI Official Full Name
Homo sapiens immunoglobulin lambda-like polypeptide 1, mRNA
NCBI Official Synonym Full Names
immunoglobulin lambda like polypeptide 1
NCBI Official Symbol
IGLL1
NCBI Official Synonym Symbols
IGO; 14.1; AGM2; IGL1; IGL5; IGLL; IGVPB; CD179b; VPREB2; IGLJ14.1
NCBI Protein Information
immunoglobulin lambda-like polypeptide 1
UniProt Protein Name
Immunoglobulin lambda-like polypeptide 1
UniProt Gene Name
IGLL1
UniProt Synonym Gene Names
IGL1
UniProt Entry Name
IGLL1_HUMAN

NCBI Description

The preB cell receptor is found on the surface of proB and preB cells, where it is involved in transduction of signals for cellular proliferation, differentiation from the proB cell to the preB cell stage, allelic exclusion at the Ig heavy chain gene locus, and promotion of Ig light chain gene rearrangements. The preB cell receptor is composed of a membrane-bound Ig mu heavy chain in association with a heterodimeric surrogate light chain. This gene encodes one of the surrogate light chain subunits and is a member of the immunoglobulin gene superfamily. This gene does not undergo rearrangement. Mutations in this gene can result in B cell deficiency and agammaglobulinemia, an autosomal recessive disease in which few or no gamma globulins or antibodies are made. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

IGLL1: Critical for B-cell development. Defects in IGLL1 are the cause of agammaglobulinemia type 2 (AGM2). It is a primary immunodeficiency characterized by profoundly low or absent serum antibodies and low or absent circulating B-cells due to an early block of B-cell development. Affected individuals develop severe infections in the first years of life. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Secreted; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 22q11.23

Cellular Component: external side of plasma membrane

Molecular Function: antigen binding

Biological Process: B cell receptor signaling pathway; complement activation, classical pathway; defense response to bacterium; innate immune response; phagocytosis, engulfment; phagocytosis, recognition; positive regulation of B cell activation

Disease: Agammaglobulinemia 2, Autosomal Recessive

Research Articles on IGLL1

Similar Products

Product Notes

The IGLL1 igll1 (Catalog #AAA1276394) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaggccag ggacaggcca ggggggcctt gaggcccctg gtgagccagg ccccaacctc aggcagcgct ggcccctgct gctgctgggt ctggccgtgg taacccatgg cctgctgcgc ccaacagctg catcgcagag cagggccctg ggccctggag cccctggagg aagcagccgg tccagcctga ggagccggtg gggcaggttc ctgctccagc gcggctcctg gactggcccc aggtgctggc cccgggggtt tcaatccaag cataactcag tgacgcatgt gtttggcagc gggacccagc tcaccgtttt aagtcagccc aaggccaccc cctcggtcac tctgttcccg ccgtcctctg aggagctcca agccaacaag gctacactgg tgtgtctcat gaatgacttt tatccgggaa tcttgacggt gacctggaag gcagatggta cccccatcac ccagggcgtg gagatgacca cgccctccaa acagagcaac aacaagtacg cggccagcag ctacctgagc ctgacgcccg agcagtggag gtcccgcaga agctacagct gccaggtcat gcacgaaggg agcaccgtgg agaagacggt ggcccctgca gaatgttcat ag. It is sometimes possible for the material contained within the vial of "IGLL1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.