IGKC cdna clone
IGKC cDNA Clone
Gene Names
IGKC; Km; HCAK1; IGKCD
Synonyms
IGKC; IGKC cDNA Clone; IGKC cdna clone
Sequence
ATGAGGCTCCCTGCTCAGCTCCTGGGGCTGCTAATGCTCTGGGTCCCAGGATCCAGTGGGGATGTTGTGATGACTCAGTCTCCACTCTCCCTGCCCGTCACCCTTGGACAGCCGGCCTCCATCTCCTGCAGGTCTAGTCAAAGCCTCGTATACAGTGATGGAAACACCTACTTGAATTGGTTTCAGCAGAGGCCAGGCCAATCTCCAAGGCGCCTAATTTATAAGGTTTCTATCCGGGACTCTGGGGTCCCAGACAAATTCAGCGGCAGTGGGTCAGGCACTGATTTCACACTGAAAATCAGCAGGGTGGAGGCTGAGGATGTTGGGGTTTATTACTGCATGCAAGGTTCACACTGGCCTCCGATCACCTTCGGCCAAGGGACACGACTGGAGATTAAACGAACTGTGGCTGCACCATCTGTCTTCATCTTCCCGCCATCTGATGAGCAGTTGAAATCTGGAACTGCCTCTGTTGTGTGCCTGCTGAATAACTTCTATCCCAGAGAGGCCAAAGTACAGTGGAAGGTGGATAACGCCCTCCAATCGGGTAACTCCCAGGAGAGTGTCACAGAGCAGGACAGCAAGGACAGCACCTACAGCCTCAGCAGCACCCTGACGCTGAGCAAAGCAGACTACGAGAAACACAAAGTCTACGCCTGCGAAGTCACCCATCAGGGCCTGAGCTCGCCCGTCACAAAGAGCTTCAACAGGGGAGAGTGTTAG
Sequence Length
723
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
11,609 Da
NCBI Official Full Name
Homo sapiens immunoglobulin kappa constant, mRNA
NCBI Official Synonym Full Names
immunoglobulin kappa constant
NCBI Official Symbol
IGKC
NCBI Official Synonym Symbols
Km; HCAK1; IGKCD
UniProt Protein Name
Ig kappa chain C region
UniProt Gene Name
IGKC
UniProt Entry Name
IGKC_HUMAN
Uniprot Description
IGKC: Defects in IGKC are the cause of immunoglobulin kappa light chain deficiency (IGKCD). IGKCD is a disease characterized by the complete absence of immunoglobulin kappa chains.
Chromosomal Location of Human Ortholog: 2p12
Cellular Component: external side of plasma membrane; extracellular region; extracellular space; plasma membrane
Molecular Function: antigen binding; serine-type endopeptidase activity
Biological Process: B cell receptor signaling pathway; complement activation; complement activation, classical pathway; defense response to bacterium; innate immune response; phagocytosis, engulfment; phagocytosis, recognition; positive regulation of B cell activation; receptor-mediated endocytosis; regulation of immune response; retinal homeostasis
Research Articles on IGKC
Similar Products
Product Notes
The IGKC igkc (Catalog #AAA1278601) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGAGGCTCC CTGCTCAGCT CCTGGGGCTG CTAATGCTCT GGGTCCCAGG ATCCAGTGGG GATGTTGTGA TGACTCAGTC TCCACTCTCC CTGCCCGTCA CCCTTGGACA GCCGGCCTCC ATCTCCTGCA GGTCTAGTCA AAGCCTCGTA TACAGTGATG GAAACACCTA CTTGAATTGG TTTCAGCAGA GGCCAGGCCA ATCTCCAAGG CGCCTAATTT ATAAGGTTTC TATCCGGGAC TCTGGGGTCC CAGACAAATT CAGCGGCAGT GGGTCAGGCA CTGATTTCAC ACTGAAAATC AGCAGGGTGG AGGCTGAGGA TGTTGGGGTT TATTACTGCA TGCAAGGTTC ACACTGGCCT CCGATCACCT TCGGCCAAGG GACACGACTG GAGATTAAAC GAACTGTGGC TGCACCATCT GTCTTCATCT TCCCGCCATC TGATGAGCAG TTGAAATCTG GAACTGCCTC TGTTGTGTGC CTGCTGAATA ACTTCTATCC CAGAGAGGCC AAAGTACAGT GGAAGGTGGA TAACGCCCTC CAATCGGGTA ACTCCCAGGA GAGTGTCACA GAGCAGGACA GCAAGGACAG CACCTACAGC CTCAGCAGCA CCCTGACGCT GAGCAAAGCA GACTACGAGA AACACAAAGT CTACGCCTGC GAAGTCACCC ATCAGGGCCT GAGCTCGCCC GTCACAAAGA GCTTCAACAG GGGAGAGTGT TAG. It is sometimes possible for the material contained within the vial of "IGKC, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
