Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

IFT57 cdna clone

IFT57 cDNA Clone

Gene Names
IFT57; HIPPI; MHS4R2; ESRRBL1
Synonyms
IFT57; IFT57 cDNA Clone; IFT57 cdna clone
Ordering
For Research Use Only!
Sequence
atgactgctgctctggccgtcgtcacgacgtcgggtttggaagatggggtgcctaggtcccgtggcgaagggaccggggaagtggtcttggagcgggggcccggcgcggcctaccacatgttcgtggtgatggaggacttggtggagaagctgaagctgctccgctacgaggaggagttcctccggaagagcaacctgaaggccccgtccagacactattttgcactgcctaccaaccctggcgaacagttctacatgttttgtactcttgctgcttggttgattaataaagcgggacgtccctttgagcagcctcaagaatatgatgaccctaatgcaacaatatctaacatactatccgagcttcggtcatttggaagaactgcagattttcctccttcaaaattaaagtcaggttatggagaacatgtatgctatgttcttgattgcttcgctgaagaagcattgaaatatattggtttcacctggaaaaggccaatatacccagtagaagaattagaagaagaaagcgttgcagaagatgatgcagaattaacattaaataaagtggatgaagaatttgtggaagaagagacagataatgaagaaaactttattgatctcaacgttttaaaggcccagacatatcacttggatatgaacgagactgccaaacaagaagatattttggaatccacaacagatgctgcagaatggagcctagaagtggaacgtgtactaccgcaactgaaagtcacgattaggactgacaataaggattggagaatccatgttgaccaaatgcaccagcacagaagtggaattgaatctgctctaaaggagaccaagggatttttggacaaactccataatgaaattactaggactttggaaaagatcagcagccgagaaaagtacatcaacaatcagcttgagaatttggttcaagaatatcgtgcagctcaagcccagctgagtgaggcaaaggagcgataccagcagggaaatggaggagtgacggaaagaaccagactcctctctgaggttatggaagaattagaaaaggtaaaacaagaaatggaagaaaagggcagcagcatgactgatggtgctcctttggtgaagattaaacagagcttaacaaaactgaagcaagaaactgtagagatggacattagaattggcattgtggaacacacactactccaatcaaagctgaaggagaagtccaacatgactaggaacatgcatgccacagttattccagaaccagcaacaggcttttattaa
Sequence Length
1290
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
49,108 Da
NCBI Official Full Name
Homo sapiens intraflagellar transport 57 homolog (Chlamydomonas), mRNA
NCBI Official Synonym Full Names
intraflagellar transport 57
NCBI Official Symbol
IFT57
NCBI Official Synonym Symbols
HIPPI; MHS4R2; ESRRBL1
NCBI Protein Information
intraflagellar transport protein 57 homolog
UniProt Protein Name
Intraflagellar transport protein 57 homolog
UniProt Gene Name
IFT57
UniProt Synonym Gene Names
DERP8; ESRRBL1; HIPPI
UniProt Entry Name
IFT57_HUMAN

Uniprot Description

IFT57: Required for the formation of cilia. Plays an indirect role in sonic hedgehog signaling, cilia being required for all activity of the hedgehog pathway. Has pro- apoptotic function via its interaction with HIP1, leading to recruit caspase-8 (CASP8) and trigger apoptosis. Has the ability to bind DNA sequence motif 5'-AAAGACATG-3' present in the promoter of caspase genes such as CASP1, CASP8 and CASP10, suggesting that it may act as a transcription regulator; however the relevance of such function remains unclear. Belongs to the IFT57 family.

Chromosomal Location of Human Ortholog: 3q13.13

Cellular Component: centrosome; cilium; Golgi apparatus

Molecular Function: protein binding

Biological Process: apoptosis; caspase activation; cilium biogenesis; intraflagellar transport; regulation of apoptosis

Research Articles on IFT57

Similar Products

Product Notes

The IFT57 ift57 (Catalog #AAA1272661) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgactgctg ctctggccgt cgtcacgacg tcgggtttgg aagatggggt gcctaggtcc cgtggcgaag ggaccgggga agtggtcttg gagcgggggc ccggcgcggc ctaccacatg ttcgtggtga tggaggactt ggtggagaag ctgaagctgc tccgctacga ggaggagttc ctccggaaga gcaacctgaa ggccccgtcc agacactatt ttgcactgcc taccaaccct ggcgaacagt tctacatgtt ttgtactctt gctgcttggt tgattaataa agcgggacgt ccctttgagc agcctcaaga atatgatgac cctaatgcaa caatatctaa catactatcc gagcttcggt catttggaag aactgcagat tttcctcctt caaaattaaa gtcaggttat ggagaacatg tatgctatgt tcttgattgc ttcgctgaag aagcattgaa atatattggt ttcacctgga aaaggccaat atacccagta gaagaattag aagaagaaag cgttgcagaa gatgatgcag aattaacatt aaataaagtg gatgaagaat ttgtggaaga agagacagat aatgaagaaa actttattga tctcaacgtt ttaaaggccc agacatatca cttggatatg aacgagactg ccaaacaaga agatattttg gaatccacaa cagatgctgc agaatggagc ctagaagtgg aacgtgtact accgcaactg aaagtcacga ttaggactga caataaggat tggagaatcc atgttgacca aatgcaccag cacagaagtg gaattgaatc tgctctaaag gagaccaagg gatttttgga caaactccat aatgaaatta ctaggacttt ggaaaagatc agcagccgag aaaagtacat caacaatcag cttgagaatt tggttcaaga atatcgtgca gctcaagccc agctgagtga ggcaaaggag cgataccagc agggaaatgg aggagtgacg gaaagaacca gactcctctc tgaggttatg gaagaattag aaaaggtaaa acaagaaatg gaagaaaagg gcagcagcat gactgatggt gctcctttgg tgaagattaa acagagctta acaaaactga agcaagaaac tgtagagatg gacattagaa ttggcattgt ggaacacaca ctactccaat caaagctgaa ggagaagtcc aacatgacta ggaacatgca tgccacagtt attccagaac cagcaacagg cttttattaa. It is sometimes possible for the material contained within the vial of "IFT57, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.