IFRD2 cdna clone
IFRD2 cDNA Clone
Gene Names
IFRD2; SM15; IFNRP; SKMc15
Synonyms
IFRD2; IFRD2 cDNA Clone; IFRD2 cdna clone
Sequence
atgcctcgcgcccgtaagggcaacacgctccggaagggtggtcagcgccgtggaggaggtgcccggagcagtgcccaagctgactcgggttccagtgacgatgaggcagccagtgaggcccgcagcaccgccagtgaatgccccagccttctcagcaccactgcagaggacagccttgggggggatgtcgtggatgagcagggccagcaggaagaccttgaggaaaagctgaaggagtatgtggactgtctcacagacaagagtgccaagacccggcagggtgctcttgagagcctgcgcctggccctagcgtcccgcctactccccgacttcttgctggagcgccgcctcacgctagccgatgccctggaaaagtgcctcaagaaagggaagggcgaggaacaagccctggctgctgctgtgctaggcctgctctgcgtgcagctgggccctggacctaagggtgaggagctgtttcacagcctgcagcctctgctggtctctgtgctcagtgacagcacagctagccctgctgcccggctccactgtgcttctgcccttggcctgggctgctacgtggctgccgctgacatccaggacctggtctcttgccttgcctgcttagaaagtgttttcagccggttctatggcttggggggcagctccacaagtcctgtggttcctgccagcctgcacggcctgctctctgctgccctgcaggcctgggcattgctgctcaccatctgccctagcacccaaatcagccacatccttgacaggcagctgccccggctgccccagctcttgtccagtgaaagtgtgaacctgcggatcgctgccggtgaaaccattgcactgctctttgagcttgcccgggaccttgaggaggagtttgtttacgaggacatggaggccctctgcagtgtcctgcgcactctggccactgacagtaacaagtaccgtgccaaggctgatcgtcggcgccagcgctctactttccgcgccgtgctgcactccgtggagggcggtgaatgcgaagaagagatagtgcgcttcggctttgaggtgctctacatggacagctgggctcggcaccggatctacgctgccttcaaggaagtgctgggttcgggcatgcaccaccacctccagaacaatgagctactccgtgacatctttggcctgggccctgtgctgttgctggatgccactgccctgaaggcctgcaaggttccacgctttgagaagcacctgtacaatgctgctgccttcaaagcccggaccaaggctcgaagccgtgtgcgggacaagcgggcagacatcctgtga
Sequence Length
1329
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
65,598 Da
NCBI Official Full Name
Homo sapiens interferon-related developmental regulator 2, mRNA
NCBI Official Synonym Full Names
interferon related developmental regulator 2
NCBI Official Symbol
IFRD2
NCBI Official Synonym Symbols
SM15; IFNRP; SKMc15
NCBI Protein Information
interferon-related developmental regulator 2
UniProt Protein Name
Interferon-related developmental regulator 2
Protein Family
UniProt Gene Name
IFRD2
UniProt Entry Name
IFRD2_HUMAN
Uniprot Description
IFRD2: Belongs to the IFRD family.
Protein type: Unknown function
Chromosomal Location of Human Ortholog: 3p21.3
Cellular Component: nucleus
Molecular Function: protein binding
Research Articles on IFRD2
Similar Products
Product Notes
The IFRD2 ifrd2 (Catalog #AAA1275590) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcctcgcg cccgtaaggg caacacgctc cggaagggtg gtcagcgccg tggaggaggt gcccggagca gtgcccaagc tgactcgggt tccagtgacg atgaggcagc cagtgaggcc cgcagcaccg ccagtgaatg ccccagcctt ctcagcacca ctgcagagga cagccttggg ggggatgtcg tggatgagca gggccagcag gaagaccttg aggaaaagct gaaggagtat gtggactgtc tcacagacaa gagtgccaag acccggcagg gtgctcttga gagcctgcgc ctggccctag cgtcccgcct actccccgac ttcttgctgg agcgccgcct cacgctagcc gatgccctgg aaaagtgcct caagaaaggg aagggcgagg aacaagccct ggctgctgct gtgctaggcc tgctctgcgt gcagctgggc cctggaccta agggtgagga gctgtttcac agcctgcagc ctctgctggt ctctgtgctc agtgacagca cagctagccc tgctgcccgg ctccactgtg cttctgccct tggcctgggc tgctacgtgg ctgccgctga catccaggac ctggtctctt gccttgcctg cttagaaagt gttttcagcc ggttctatgg cttggggggc agctccacaa gtcctgtggt tcctgccagc ctgcacggcc tgctctctgc tgccctgcag gcctgggcat tgctgctcac catctgccct agcacccaaa tcagccacat ccttgacagg cagctgcccc ggctgcccca gctcttgtcc agtgaaagtg tgaacctgcg gatcgctgcc ggtgaaacca ttgcactgct ctttgagctt gcccgggacc ttgaggagga gtttgtttac gaggacatgg aggccctctg cagtgtcctg cgcactctgg ccactgacag taacaagtac cgtgccaagg ctgatcgtcg gcgccagcgc tctactttcc gcgccgtgct gcactccgtg gagggcggtg aatgcgaaga agagatagtg cgcttcggct ttgaggtgct ctacatggac agctgggctc ggcaccggat ctacgctgcc ttcaaggaag tgctgggttc gggcatgcac caccacctcc agaacaatga gctactccgt gacatctttg gcctgggccc tgtgctgttg ctggatgcca ctgccctgaa ggcctgcaag gttccacgct ttgagaagca cctgtacaat gctgctgcct tcaaagcccg gaccaaggct cgaagccgtg tgcgggacaa gcgggcagac atcctgtga. It is sometimes possible for the material contained within the vial of "IFRD2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
