Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

IFIT3 cdna clone

IFIT3 cDNA Clone

Gene Names
IFIT3; P60; IRG2; IFI60; IFIT4; ISG60; RIG-G; cig41; CIG-49; GARG-49
Synonyms
IFIT3; IFIT3 cDNA Clone; IFIT3 cdna clone
Ordering
For Research Use Only!
Sequence
atgagtgaggtcaccaagaattccctggagaaaatccttccacagctgaaatgccatttcacctggaacttattcaaggaagacagtgtctcaagggatctagaagatagagtgtgtaaccagattgaatctttaaacactgagttcaaagctacaatgtacaacttgttggcctacataaaacacctagatggtaacaacgaggcagccctggaatgcttacggcaagctgaagagttaatccagcaagaacatgctgaccaagcagaaatcagaagtctagtcacttggggaaactacgcctgggtctactatcacttgggcagactctcagatgctcagatttatgtagataaggtgaaacaaacctgcaagaaattttcaaatccatacagtattgagtattctgaacttgactgtgaggaagggtggacacaactgaagtgtggaagaaatgaaagggcgaaggtgtgttttgagaaggctctggaagaaaagcccaacaacccagaattctcctctggactggcaattgcgatgtaccatctggataatcacccagagaaacagttctctactgatgttttgaagcaggccattgagctgagtcctgataaccaatacgtcaaggttctcttgggcctgaaactgcagaagatgaataaagaagctgaaggagagcagtttgttgaagaagccttggaaaagtctccttgccaaacagatgtcctccgcagtgcagccaaattttacagaagaaaaggtgacctagacaaagctattgaactgtttcaacgggtgttggaatccacaccaaacaatggctacctctatcaccagattgggtgctgctacaaggcaaaagtaagacaaatgcagaatacaggagaatctgaagctagtggaaataaagagatgattgaagcactaaagcaatatgctatggactattcgaataaagctcttgagaagggactgaatcctctgaatgcatactccgatctcgctgagttcctggagacggaatgttatcagacaccattcaataaggaagtccctgatgctgaaaagcaacaatcccatcagcgctactgcaaccttcagaaatataatgggaagtctgaagacactgctgtgcaacatggtttagagggtttgtccataagcaaaaaatcaactgacaaggaagagatcaaagaccaaccacagaatgtatctgaaaatctgcttccacaaaatgcaccaaattattggtatcttcaaggattaattcataagcagaatggagatctgctgcaagcagccaaatgttatgagaaggaactgggccgcctgctaagggatgccccttcaggcataggcagtattttcctgtcagcatctgagcttgaggatggtagtgaggaaatgggccagggcgcagtcagctccagtcccagagagctcctctctaactcagagcaactgaactga
Sequence Length
1473
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
55,985 Da
NCBI Official Full Name
Homo sapiens interferon-induced protein with tetratricopeptide repeats 3, mRNA
NCBI Official Synonym Full Names
interferon induced protein with tetratricopeptide repeats 3
NCBI Official Symbol
IFIT3
NCBI Official Synonym Symbols
P60; IRG2; IFI60; IFIT4; ISG60; RIG-G; cig41; CIG-49; GARG-49
NCBI Protein Information
interferon-induced protein with tetratricopeptide repeats 3
UniProt Protein Name
Interferon-induced protein with tetratricopeptide repeats 3
UniProt Gene Name
IFIT3
UniProt Synonym Gene Names
CIG-49; IFI60; IFIT4; ISG60; IFIT-3; IFI-60K; IFIT-4; P60; RIG-G
UniProt Entry Name
IFIT3_HUMAN

Uniprot Description

IFIT3: IFN-induced antiviral protein which acts as an inhibitor of cellular as well as viral processes, cell migration, proliferation, signaling, and viral replication. Enhances MAVS- mediated host antiviral responses by serving as an adapter bridging TBK1 to MAVS which leads to the activation of TBK1 and phosphorylation of IRF3 and phosphorylated IRF3 translocates into nucleus to promote antiviral gene transcription. Exihibits an antiproliferative activity via the up-regulation of cell cycle negative regulators CDKN1A/p21 and CDKN1B/p27. Normally, CDKN1B/p27 turnover is regulated by COPS5, which binds CDKN1B/p27 in the nucleus and exports it to the cytoplasm for ubiquitin- dependent degradation. IFIT3 sequesters COPS5 in the cytoplasm, thereby increasing nuclear CDKN1B/p27 protein levels. Upregulates CDKN1A/p21 by downregulating MYC, a repressor of CDKN1A/p21. Can negatively regulate the apoptotic effects of IFIT2. Belongs to the IFIT family.

Protein type: Unknown function

Chromosomal Location of Human Ortholog: 10q24

Cellular Component: cytoplasm; cytosol; mitochondrion

Molecular Function: identical protein binding; protein binding; RNA binding

Biological Process: defense response to virus; negative regulation of apoptosis; negative regulation of cell proliferation; response to virus

Research Articles on IFIT3

Similar Products

Product Notes

The IFIT3 ifit3 (Catalog #AAA1272246) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagtgagg tcaccaagaa ttccctggag aaaatccttc cacagctgaa atgccatttc acctggaact tattcaagga agacagtgtc tcaagggatc tagaagatag agtgtgtaac cagattgaat ctttaaacac tgagttcaaa gctacaatgt acaacttgtt ggcctacata aaacacctag atggtaacaa cgaggcagcc ctggaatgct tacggcaagc tgaagagtta atccagcaag aacatgctga ccaagcagaa atcagaagtc tagtcacttg gggaaactac gcctgggtct actatcactt gggcagactc tcagatgctc agatttatgt agataaggtg aaacaaacct gcaagaaatt ttcaaatcca tacagtattg agtattctga acttgactgt gaggaagggt ggacacaact gaagtgtgga agaaatgaaa gggcgaaggt gtgttttgag aaggctctgg aagaaaagcc caacaaccca gaattctcct ctggactggc aattgcgatg taccatctgg ataatcaccc agagaaacag ttctctactg atgttttgaa gcaggccatt gagctgagtc ctgataacca atacgtcaag gttctcttgg gcctgaaact gcagaagatg aataaagaag ctgaaggaga gcagtttgtt gaagaagcct tggaaaagtc tccttgccaa acagatgtcc tccgcagtgc agccaaattt tacagaagaa aaggtgacct agacaaagct attgaactgt ttcaacgggt gttggaatcc acaccaaaca atggctacct ctatcaccag attgggtgct gctacaaggc aaaagtaaga caaatgcaga atacaggaga atctgaagct agtggaaata aagagatgat tgaagcacta aagcaatatg ctatggacta ttcgaataaa gctcttgaga agggactgaa tcctctgaat gcatactccg atctcgctga gttcctggag acggaatgtt atcagacacc attcaataag gaagtccctg atgctgaaaa gcaacaatcc catcagcgct actgcaacct tcagaaatat aatgggaagt ctgaagacac tgctgtgcaa catggtttag agggtttgtc cataagcaaa aaatcaactg acaaggaaga gatcaaagac caaccacaga atgtatctga aaatctgctt ccacaaaatg caccaaatta ttggtatctt caaggattaa ttcataagca gaatggagat ctgctgcaag cagccaaatg ttatgagaag gaactgggcc gcctgctaag ggatgcccct tcaggcatag gcagtatttt cctgtcagca tctgagcttg aggatggtag tgaggaaatg ggccagggcg cagtcagctc cagtcccaga gagctcctct ctaactcaga gcaactgaac tga. It is sometimes possible for the material contained within the vial of "IFIT3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.