IFI44 cdna clone
IFI44 cDNA Clone
Gene Names
IFI44; p44; TLDC5; MTAP44
Synonyms
IFI44; IFI44 cDNA Clone; IFI44 cdna clone
Sequence
atggcagtgacaactcgtttgacacggttgcacgaaaagatcctgcaaaatcattttggagggaagcggcttagccttctctataagggtagtgtccatggattccgtaatggagttttgcttgacagatgttgtaatcaagggcctactctaacagtgatttatagtgaagatcatattattggagcatatgcggaagagagttaccaggaaggaaagtatgcttccatcatcctttttgcacttcaagatactaaaatttcagaatggaaactaggactatgtacaccagaaacactgttttgttgtgatgttacaaaatataactccccaactaatttccagatagatggaagaaatagaaaagtgattatggacttaaagacaatggaaaatcttggacttgctcaaaattgtactatctctattcaggattatgaagtttttcgatgcgaagattcactggatgaaagaaagataaaaggggtcattgagctcaggaagagcttactgtctgccttgagaacttatgaaccatatggatccctggttcaacaaatacgaattctgctgctgggtccaattggagctgggaagtccagctttttcaactcagtgaggtctgttttccaagggcatgtaacgcatcaggctttggtgggcactaatacaactgggatatctgagaagtataggacatactctattagagacgggaaagatggcaaatacctgccgtttattctgtgtgactcactggggctgagtgagaaagaaggcggcctgtgcagggatgacatattctatatcttgaacggtaacattcgtgatagataccagtttaatcccatggaatcaatcaaattaaatcatcatgactacattgattccccatcgctgaaggacagaattcattgtgtggcatttgtatttgatgccagctctattcaatacttctcctctcagatgatagtaaagatcaaaagaattcgaagggagttggtaaacgctggtgtggtacatgtggctttgctcactcatgtggatagcatggatttgattacaaaaggtgaccttatagaaatagagagatgtgagcctgtgaggtccaagctagaggaagtccaaagaaaacttggatttgctctttctgacatctcggtggttagcaattattcctctgagtgggagctggaccctgtaaaggatgttctaattctttctgctctgagacgaatgctatgggctgcagatgacttcttagaggatttgccttttgagcaaatagggaatctaagggaggaaattatcaactgtgcacaaggaaaaaaatag
Sequence Length
1335
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
14,984 Da
NCBI Official Full Name
Homo sapiens interferon-induced protein 44, mRNA
NCBI Official Synonym Full Names
interferon induced protein 44
NCBI Official Symbol
IFI44
NCBI Official Synonym Symbols
p44; TLDC5; MTAP44
NCBI Protein Information
interferon-induced protein 44
UniProt Protein Name
Interferon-induced protein 44
Protein Family
UniProt Gene Name
IFI44
UniProt Synonym Gene Names
MTAP44; p44
UniProt Entry Name
IFI44_HUMAN
Uniprot Description
IFI44: This protein aggregates to form microtubular structures. Belongs to the IFI44 family.
Chromosomal Location of Human Ortholog: 1p31.1
Biological Process: response to virus
Research Articles on IFI44
Similar Products
Product Notes
The IFI44 ifi44 (Catalog #AAA1265682) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcagtga caactcgttt gacacggttg cacgaaaaga tcctgcaaaa tcattttgga gggaagcggc ttagccttct ctataagggt agtgtccatg gattccgtaa tggagttttg cttgacagat gttgtaatca agggcctact ctaacagtga tttatagtga agatcatatt attggagcat atgcggaaga gagttaccag gaaggaaagt atgcttccat catccttttt gcacttcaag atactaaaat ttcagaatgg aaactaggac tatgtacacc agaaacactg ttttgttgtg atgttacaaa atataactcc ccaactaatt tccagataga tggaagaaat agaaaagtga ttatggactt aaagacaatg gaaaatcttg gacttgctca aaattgtact atctctattc aggattatga agtttttcga tgcgaagatt cactggatga aagaaagata aaaggggtca ttgagctcag gaagagctta ctgtctgcct tgagaactta tgaaccatat ggatccctgg ttcaacaaat acgaattctg ctgctgggtc caattggagc tgggaagtcc agctttttca actcagtgag gtctgttttc caagggcatg taacgcatca ggctttggtg ggcactaata caactgggat atctgagaag tataggacat actctattag agacgggaaa gatggcaaat acctgccgtt tattctgtgt gactcactgg ggctgagtga gaaagaaggc ggcctgtgca gggatgacat attctatatc ttgaacggta acattcgtga tagataccag tttaatccca tggaatcaat caaattaaat catcatgact acattgattc cccatcgctg aaggacagaa ttcattgtgt ggcatttgta tttgatgcca gctctattca atacttctcc tctcagatga tagtaaagat caaaagaatt cgaagggagt tggtaaacgc tggtgtggta catgtggctt tgctcactca tgtggatagc atggatttga ttacaaaagg tgaccttata gaaatagaga gatgtgagcc tgtgaggtcc aagctagagg aagtccaaag aaaacttgga tttgctcttt ctgacatctc ggtggttagc aattattcct ctgagtggga gctggaccct gtaaaggatg ttctaattct ttctgctctg agacgaatgc tatgggctgc agatgacttc ttagaggatt tgccttttga gcaaataggg aatctaaggg aggaaattat caactgtgca caaggaaaaa aatag. It is sometimes possible for the material contained within the vial of "IFI44, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
