Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

IER2 cdna clone

IER2 cDNA Clone

Gene Names
IER2; ETR101
Synonyms
IER2; IER2 cDNA Clone; IER2 cdna clone
Ordering
For Research Use Only!
Sequence
atggaagtgcagaaagaggcacagcgcatcatgaccctgtcggtgtggaagatgtatcactcccgcatgcagcgcggtggcctgcggctgcaccggagtctgcagctgtcgctggtcatgcgcagcgcccgggagctctacctctcggccaaggtggaggccctcgagcccgaggtgtcgttgccggccgccctcccctctgaccctcgcctgcacccgccccgagaagccgagtccacggccgagacagcgacccccgacggtgagcacccgtttccggagccaatggacacgcaggaggcgccgacagccgaggagacctccgcctgctgtgccccgcgccccgccaaagtcagccgcaaacgacgcagcagcagcctgagcgacggcggggacgctggactggtcccgagcaagaaagcccgtctggaagaaaaggaagaagaggagggagcgtcatccgaagtcgccgatcgcctgcagccccctccggcgcaagcggagggcgcctttcccaacctggcccgcgtcctgcagaggcgcttctccggcctcctgaactgcagccccgcggcccctccgacggcgccgcccgcgtgcgaggcaaagcccgcttgccgcccggcggacagcatgctcaacgtgctcgtgcgggccgtggtggccttctga
Sequence Length
672
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
24,196 Da
NCBI Official Full Name
Homo sapiens immediate early response 2, mRNA
NCBI Official Synonym Full Names
immediate early response 2
NCBI Official Symbol
IER2
NCBI Official Synonym Symbols
ETR101
NCBI Protein Information
immediate early response gene 2 protein
UniProt Protein Name
Immediate early response gene 2 protein
UniProt Gene Name
IER2
UniProt Entry Name
IER2_HUMAN

Uniprot Description

IER2: Belongs to the IER family.

Protein type: Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 19p13.2

Cellular Component: cytoplasm; nucleoplasm; nucleus

Molecular Function: DNA binding

Biological Process: cell motility involved in cell locomotion; neuron differentiation

Research Articles on IER2

Similar Products

Product Notes

The IER2 ier2 (Catalog #AAA1276592) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaagtgc agaaagaggc acagcgcatc atgaccctgt cggtgtggaa gatgtatcac tcccgcatgc agcgcggtgg cctgcggctg caccggagtc tgcagctgtc gctggtcatg cgcagcgccc gggagctcta cctctcggcc aaggtggagg ccctcgagcc cgaggtgtcg ttgccggccg ccctcccctc tgaccctcgc ctgcacccgc cccgagaagc cgagtccacg gccgagacag cgacccccga cggtgagcac ccgtttccgg agccaatgga cacgcaggag gcgccgacag ccgaggagac ctccgcctgc tgtgccccgc gccccgccaa agtcagccgc aaacgacgca gcagcagcct gagcgacggc ggggacgctg gactggtccc gagcaagaaa gcccgtctgg aagaaaagga agaagaggag ggagcgtcat ccgaagtcgc cgatcgcctg cagccccctc cggcgcaagc ggagggcgcc tttcccaacc tggcccgcgt cctgcagagg cgcttctccg gcctcctgaa ctgcagcccc gcggcccctc cgacggcgcc gcccgcgtgc gaggcaaagc ccgcttgccg cccggcggac agcatgctca acgtgctcgt gcgggccgtg gtggccttct ga. It is sometimes possible for the material contained within the vial of "IER2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.