Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

IDI1 cdna clone

IDI1 cDNA Clone

Gene Names
IDI1; IPP1; IPPI1
Synonyms
IDI1; IDI1 cDNA Clone; IDI1 cdna clone
Ordering
For Research Use Only!
Sequence
atgatgcctgaaataaacactaaccacctcgacaagcaacaggttcaactcctggcagagatgtgtatccttattgatgaaaatgacaataaaattggagctgagaccaagaagaattgtcacctgaacgagaacattgagaaaggattattgcatcgagcttttagtgtcttcttattcaacaccgaaaataagcttctgctacagcaaagatcagatgctaagattacctttccaggttgttttacgaatacgtgttgtagtcatccattaagcaatccagccgagcttgaggaaagtgacacccttggagtgaggcgagcagcacagagacggctgaaagctgagctaggaattcccttggaagaggttcctccagaagaaattaattatttaacacgaattcactacaaagctcagtctgatggtatctggggtgaacatgaaattgattacattttgttggtgaggaagaatgtaactttgaatccagatcccaatgagattaaaagctattgttatgtgtcaaaggaagaactaaaagaacttctgaaaaaagcagccagtggtgaaattaagataacgccatggtttaaaattattgcagcgacttttctctttaaatggtgggataacttaaatcatttgaatcagtttgttgaccatgagaaaatatacagaatgtga
Sequence Length
687
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
32,485 Da
NCBI Official Full Name
Homo sapiens isopentenyl-diphosphate delta isomerase 1, mRNA
NCBI Official Synonym Full Names
isopentenyl-diphosphate delta isomerase 1
NCBI Official Symbol
IDI1
NCBI Official Synonym Symbols
IPP1; IPPI1
NCBI Protein Information
isopentenyl-diphosphate Delta-isomerase 1
UniProt Protein Name
Isopentenyl-diphosphate Delta-isomerase 1
UniProt Gene Name
IDI1
UniProt Synonym Gene Names
IPP isomerase 1; IPPI1
UniProt Entry Name
IDI1_HUMAN

NCBI Description

IDI1 encodes a peroxisomally-localized enzyme that catalyzes the interconversion of isopentenyl diphosphate (IPP) to its highly electrophilic isomer, dimethylallyl diphosphate (DMAPP), which are the substrates for the successive reaction that results in the synthesis of farnesyl diphosphate and, ultimately, cholesterol. It has been shown in peroxisomal deficiency diseases such as Zellweger syndrome and neonatal adrenoleukodystrophy that there is reduction in IPP isomerase activity. [provided by RefSeq, Jul 2008]

Uniprot Description

IDI1: Catalyzes the 1,3-allylic rearrangement of the homoallylic substrate isopentenyl (IPP) to its highly electrophilic allylic isomer, dimethylallyl diphosphate (DMAPP). Belongs to the IPP isomerase type 1 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Isomerase; Mitochondrial; EC 5.3.3.2; Secondary Metabolites Metabolism - terpenoid backbone biosynthesis

Chromosomal Location of Human Ortholog: 10p15.3

Cellular Component: cytosol; peroxisome

Biological Process: cholesterol biosynthetic process

Research Articles on IDI1

Similar Products

Product Notes

The IDI1 idi1 (Catalog #AAA1272245) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatgcctg aaataaacac taaccacctc gacaagcaac aggttcaact cctggcagag atgtgtatcc ttattgatga aaatgacaat aaaattggag ctgagaccaa gaagaattgt cacctgaacg agaacattga gaaaggatta ttgcatcgag cttttagtgt cttcttattc aacaccgaaa ataagcttct gctacagcaa agatcagatg ctaagattac ctttccaggt tgttttacga atacgtgttg tagtcatcca ttaagcaatc cagccgagct tgaggaaagt gacacccttg gagtgaggcg agcagcacag agacggctga aagctgagct aggaattccc ttggaagagg ttcctccaga agaaattaat tatttaacac gaattcacta caaagctcag tctgatggta tctggggtga acatgaaatt gattacattt tgttggtgag gaagaatgta actttgaatc cagatcccaa tgagattaaa agctattgtt atgtgtcaaa ggaagaacta aaagaacttc tgaaaaaagc agccagtggt gaaattaaga taacgccatg gtttaaaatt attgcagcga cttttctctt taaatggtgg gataacttaa atcatttgaa tcagtttgtt gaccatgaga aaatatacag aatgtga. It is sometimes possible for the material contained within the vial of "IDI1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.