Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ID3 cdna clone

ID3 cDNA Clone

Gene Names
ID3; HEIR-1; bHLHb25
Synonyms
ID3; ID3 cDNA Clone; ID3 cdna clone
Ordering
For Research Use Only!
Sequence
atgaaggcgctgagcccggtgcgcggctgctacgaggcggtgtgctgcctgtcggaacgcagtctggccatcgcccggggccgagggaagggcccggcagctgaggagccgctgagcttgctggacgacatgaaccactgctactcccgcctgcgggaactggtacccggagtcccgagaggcactcagcttagccaggtggaaatcctacagcgcgtcatcgactacattctcgacctgcaggtagtcctggccgagccagcccctggaccccctgatggcccccaccttcccatccagacagccgagctcgctccggaacttgtcatctccaacgacaaaaggagcttttgccactga
Sequence Length
360
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
12,999 Da
NCBI Official Full Name
Homo sapiens inhibitor of DNA binding 3, dominant negative helix-loop-helix protein, mRNA
NCBI Official Synonym Full Names
inhibitor of DNA binding 3, HLH protein
NCBI Official Symbol
ID3
NCBI Official Synonym Symbols
HEIR-1; bHLHb25
NCBI Protein Information
DNA-binding protein inhibitor ID-3
UniProt Protein Name
DNA-binding protein inhibitor ID-3
UniProt Gene Name
ID3
UniProt Synonym Gene Names
1R21; BHLHB25; HEIR1; bHLHb25
UniProt Entry Name
ID3_HUMAN

NCBI Description

The protein encoded by this gene is a helix-loop-helix (HLH) protein that can form heterodimers with other HLH proteins. However, the encoded protein lacks a basic DNA-binding domain and therefore inhibits the DNA binding of any HLH protein with which it interacts. [provided by RefSeq, Aug 2011]

Uniprot Description

ID3: ID (inhibitor of DNA binding) HLH proteins lack a basic DNA-binding domain but are able to form heterodimers with other HLH proteins, thereby inhibiting DNA binding. ID-3 inhibits the binding of E2A-containing protein complexes to muscle creatine kinase E-box enhancer. May inhibit other transcription factors. Induced by phorbol 12-myristate 13-acetate (PMA). Interacts with COPS5 and COPS7A. Homodimer, and heterodimer with other HLH proteins.

Protein type: Transcription, coactivator/corepressor; DNA-binding

Chromosomal Location of Human Ortholog: 1p36.13-p36.12

Cellular Component: microtubule cytoskeleton; nucleoplasm; nucleus

Molecular Function: protein binding; transcription corepressor activity

Biological Process: multicellular organismal development; negative regulation of transcription factor activity; negative regulation of transcription, DNA-dependent

Research Articles on ID3

Similar Products

Product Notes

The ID3 id3 (Catalog #AAA1268055) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaggcgc tgagcccggt gcgcggctgc tacgaggcgg tgtgctgcct gtcggaacgc agtctggcca tcgcccgggg ccgagggaag ggcccggcag ctgaggagcc gctgagcttg ctggacgaca tgaaccactg ctactcccgc ctgcgggaac tggtacccgg agtcccgaga ggcactcagc ttagccaggt ggaaatccta cagcgcgtca tcgactacat tctcgacctg caggtagtcc tggccgagcc agcccctgga ccccctgatg gcccccacct tcccatccag acagccgagc tcgctccgga acttgtcatc tccaacgaca aaaggagctt ttgccactga. It is sometimes possible for the material contained within the vial of "ID3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.