Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HTATIP2 cdna clone

HTATIP2 cDNA Clone

Gene Names
HTATIP2; CC3; TIP30; SDR44U1
Synonyms
HTATIP2; HTATIP2 cDNA Clone; HTATIP2 cdna clone
Ordering
For Research Use Only!
Sequence
atggccgaaacagaagccctgtcgaagcttcgggaagacttcaggatgcagaataaatccgtctttattttgggcgccagcggagaaaccggcagagtgctcttaaaggaaatcctggagcagggcctgttttccaaagtcacgctcattggccggaggaagctcaccttcgacgaggaagcttataaaaatgtgaatcaagaagtggtggactttgaaaagttggatgactacgcctctgcctttcaaggtcatgatgttggattctgttgcctgggtaccaccagagggaaagctggggcggagggatttgttcgtgttgaccgagattatgtgctgaagtctgcagagctggcaaaagctggagggtgcaaacatttcaacttgctatcctctaaaggagctgataaatcaagcaattttttatatctacaagttaagggagaagtagaagccaaggttgaagaattaaaatttgatcgttactctgtatttaggcctggagttctgttatgtgataggcaagaatctcgcccaggtgaatggctggttagaaagttctttggctccttaccagactcttgggccagggggcattctgtgcctgtggtgaccgtggttagagcaatgctgaacaatgtggtgagaccaagagacaagcagatggaactgctggagaacaaggccatccatgacctggggaaagcgcatggctctctcaagccatga
Sequence Length
729
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
30,131 Da
NCBI Official Full Name
Homo sapiens HIV-1 Tat interactive protein 2, 30kDa, mRNA
NCBI Official Synonym Full Names
HIV-1 Tat interactive protein 2
NCBI Official Symbol
HTATIP2
NCBI Official Synonym Symbols
CC3; TIP30; SDR44U1
NCBI Protein Information
oxidoreductase HTATIP2
UniProt Protein Name
Oxidoreductase HTATIP2
Protein Family
UniProt Gene Name
HTATIP2
UniProt Entry Name
HTAI2_HUMAN

Uniprot Description

HTATIP2: Oxidoreductase required for tumor suppression. NAPDH- bound form inhibits nuclear import by competing with nuclear import substrates for binding to a subset of nuclear transport receptors. May act as a redox sensor linked to transcription through regulation of nuclear import. Isoform 1 is a metastasis suppressor with proapoptotic as well as antiangiogenic properties. Isoform 2 has an antiapoptotic effect. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Apoptosis; Nuclear envelope; Transcription factor; EC 1.1.1.-; Tumor suppressor; Oxidoreductase

Chromosomal Location of Human Ortholog: 11p15.1

Cellular Component: cytoplasm; membrane; nuclear envelope; nucleoplasm; nucleus

Molecular Function: protein binding; transcription coactivator activity

Biological Process: negative regulation of apoptosis; nuclear import; regulation of angiogenesis; regulation of transcription from RNA polymerase II promoter

Research Articles on HTATIP2

Similar Products

Product Notes

The HTATIP2 htatip2 (Catalog #AAA1273636) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccgaaa cagaagccct gtcgaagctt cgggaagact tcaggatgca gaataaatcc gtctttattt tgggcgccag cggagaaacc ggcagagtgc tcttaaagga aatcctggag cagggcctgt tttccaaagt cacgctcatt ggccggagga agctcacctt cgacgaggaa gcttataaaa atgtgaatca agaagtggtg gactttgaaa agttggatga ctacgcctct gcctttcaag gtcatgatgt tggattctgt tgcctgggta ccaccagagg gaaagctggg gcggagggat ttgttcgtgt tgaccgagat tatgtgctga agtctgcaga gctggcaaaa gctggagggt gcaaacattt caacttgcta tcctctaaag gagctgataa atcaagcaat tttttatatc tacaagttaa gggagaagta gaagccaagg ttgaagaatt aaaatttgat cgttactctg tatttaggcc tggagttctg ttatgtgata ggcaagaatc tcgcccaggt gaatggctgg ttagaaagtt ctttggctcc ttaccagact cttgggccag ggggcattct gtgcctgtgg tgaccgtggt tagagcaatg ctgaacaatg tggtgagacc aagagacaag cagatggaac tgctggagaa caaggccatc catgacctgg ggaaagcgca tggctctctc aagccatga. It is sometimes possible for the material contained within the vial of "HTATIP2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.