HSPA9 cdna clone
HSPA9 cDNA Clone
Gene Names
HSPA9; CSA; MOT; MOT2; SAAN; CRP40; EVPLS; GRP75; PBP74; GRP-75; HSPA9B; SIDBA4; MTHSP75; HEL-S-124m
Synonyms
HSPA9; HSPA9 cDNA Clone; HSPA9 cdna clone
Sequence
atgataagtgccagccgagctgcagcagcccgtctcgtgggcgccgcagcctcccggggccctacggccgcccgccaccaggatagctggaatggccttagtcatgaggcttttagacttgtttcaaggcgggattatgcatcagaagcaatcaagggagcagttgttggtattgatttgggtactaccaactcctgcgtggcagttatggaaggtaaacgagcaaaggtgctggagaatgccgaaggtgccagaaccaccccttcagttgtggcctttacagcagatggtgagcgacttgttggaatgccggccaagcgacaggctgtcaccaacccaaacaatacattttatgctaccaagcgtctcattggccggcgatatgatgatcctgaagtacagaaagacattaaaaatgttccctttaaaattgtccgtgcctccaatggtgatgcctgggttgaggctcatgggaaattgtattctccgagtcagattggagcatttgtgttgatgaagatgaaagagactgcagaaaattacttggggcgcacagcaaaaaatgctgtgatcacagtcccagcttatttcaatgactcgcagagacaggccactaaagatgctggccagatatctggactgaatgtgcttcgggtgattaatgagcccacagctgctgctcttgcctatggtctagacaaatcagaagacaaagtcattgctgtatatgatttaggtggtggaacttttgatatttctatcctggaaattcagaaaggagtatttgaggtgaaatccacaaatggggataccttcttaggtggggaagactttgaccaggccttgctacggcacattgtgaaggagttcaagagagagacaggggttgatttgactaaagacaacatggcacttcagagggtacgggaagctgctgaaaaggctaagtgtgaactctcctcatctgtgcagactgacatcaatttgccctatcttacaatggattcttctggacccaagcatttgaatatgaagttgacccgtgctcaatttgaagggattgtcactgatctaatcagaaggactatcgctccatgccaaaaagctatgcaagatgcagaagtcagcaagagtgacataggagaagtgattcttgtgggtggcatgactaggatgcccaaggttcagcagactgtacaggatctttttggcagagccccaagtaaagctgtcaatcctgatgaggctgtggccattggagctgccattcagggaggtgtgttggccggcgatgtcacggatgtgctgctccttgatgtcactcccctgtctctgggtattgaaactctaggaggtgtctttaccaaacttattaataggaataccactattccaaccaagaagagccaggtattctctactgccgctgatggtcaaacgcaagtggaaattaaagtgtgtcagggtgaaagagagatggctggagacaacaaactccttggacagtttactttgattggaattccaccagcccctcgtggagttcctcagattgaagttacatttgacattgatgccaatgggatagtacatgtttctgctaaagataaaggcacaggacgtgagcagcagattgtaatccagtcttctggtggattaagcaaagatgatattgaaaatatggttaaaaatgcagagaaatatgctgaagaagaccggcgaaagaaggaacgagttgaagcagttaatatggctgaaggaatcattcacgacacagaaaccaagatggaagaattcaaggaccaattacctgctgatgagtgcaacaagctgaaagaagagatttccaaaatgagggagctcctggctagaaaagacagcgaaacaggagaaaatattagacaggcagcatcctctcttcagcaggcatcattgaagctgttcgaaatggcatacaaaaagatggcatctgagcgagaaggctctggaagttctggcactggggaacaaaaggaagatcaaaaggaggaaaaacagtaa
Sequence Length
2040
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
73,680 Da
NCBI Official Full Name
Homo sapiens heat shock 70kDa protein 9 (mortalin), mRNA
NCBI Official Synonym Full Names
heat shock protein family A (Hsp70) member 9
NCBI Official Symbol
HSPA9
NCBI Official Synonym Symbols
CSA; MOT; MOT2; SAAN; CRP40; EVPLS; GRP75; PBP74; GRP-75; HSPA9B; SIDBA4; MTHSP75; HEL-S-124m
NCBI Protein Information
stress-70 protein, mitochondrial
UniProt Protein Name
Stress-70 protein, mitochondrial
Protein Family
UniProt Gene Name
HSPA9
UniProt Synonym Gene Names
GRP75; HSPA9B; mt-HSP70; GRP-75; MOT; PBP74
UniProt Entry Name
GRP75_HUMAN
NCBI Description
This gene encodes a member of the heat shock protein 70 gene family. The encoded protein is primarily localized to the mitochondria but is also found in the endoplasmic reticulum, plasma membrane and cytoplasmic vesicles. This protein is a heat-shock cognate protein. This protein plays a role in cell proliferation, stress response and maintenance of the mitochondria. A pseudogene of this gene is found on chromosome 2.[provided by RefSeq, May 2010]
Uniprot Description
HSPA9B: Implicated in the control of cell proliferation and cellular aging. May also act as a chaperone. Interacts with FXN. Interacts with HSCB. Component of the MINOS/MitOS complex, that includes IMMT, HSPA9 and CHCHD3 and associates with mitochondrial outer membrane proteins SAMM50, MTX1 and MTX2. Belongs to the heat shock protein 70 family.
Protein type: Nucleolus; Chaperone; Heat shock protein
Chromosomal Location of Human Ortholog: 5q31.1
Cellular Component: cytoplasm; extracellular matrix; focal adhesion; mitochondrion
Molecular Function: protein binding; ubiquitin protein ligase binding; unfolded protein binding
Biological Process: erythrocyte differentiation; negative regulation of apoptosis; negative regulation of erythrocyte differentiation
Disease: Anemia, Sideroblastic, 4; Even-plus Syndrome
Research Articles on HSPA9
Similar Products
Product Notes
The HSPA9 hspa9 (Catalog #AAA1275648) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgataagtg ccagccgagc tgcagcagcc cgtctcgtgg gcgccgcagc ctcccggggc cctacggccg cccgccacca ggatagctgg aatggcctta gtcatgaggc ttttagactt gtttcaaggc gggattatgc atcagaagca atcaagggag cagttgttgg tattgatttg ggtactacca actcctgcgt ggcagttatg gaaggtaaac gagcaaaggt gctggagaat gccgaaggtg ccagaaccac cccttcagtt gtggccttta cagcagatgg tgagcgactt gttggaatgc cggccaagcg acaggctgtc accaacccaa acaatacatt ttatgctacc aagcgtctca ttggccggcg atatgatgat cctgaagtac agaaagacat taaaaatgtt ccctttaaaa ttgtccgtgc ctccaatggt gatgcctggg ttgaggctca tgggaaattg tattctccga gtcagattgg agcatttgtg ttgatgaaga tgaaagagac tgcagaaaat tacttggggc gcacagcaaa aaatgctgtg atcacagtcc cagcttattt caatgactcg cagagacagg ccactaaaga tgctggccag atatctggac tgaatgtgct tcgggtgatt aatgagccca cagctgctgc tcttgcctat ggtctagaca aatcagaaga caaagtcatt gctgtatatg atttaggtgg tggaactttt gatatttcta tcctggaaat tcagaaagga gtatttgagg tgaaatccac aaatggggat accttcttag gtggggaaga ctttgaccag gccttgctac ggcacattgt gaaggagttc aagagagaga caggggttga tttgactaaa gacaacatgg cacttcagag ggtacgggaa gctgctgaaa aggctaagtg tgaactctcc tcatctgtgc agactgacat caatttgccc tatcttacaa tggattcttc tggacccaag catttgaata tgaagttgac ccgtgctcaa tttgaaggga ttgtcactga tctaatcaga aggactatcg ctccatgcca aaaagctatg caagatgcag aagtcagcaa gagtgacata ggagaagtga ttcttgtggg tggcatgact aggatgccca aggttcagca gactgtacag gatctttttg gcagagcccc aagtaaagct gtcaatcctg atgaggctgt ggccattgga gctgccattc agggaggtgt gttggccggc gatgtcacgg atgtgctgct ccttgatgtc actcccctgt ctctgggtat tgaaactcta ggaggtgtct ttaccaaact tattaatagg aataccacta ttccaaccaa gaagagccag gtattctcta ctgccgctga tggtcaaacg caagtggaaa ttaaagtgtg tcagggtgaa agagagatgg ctggagacaa caaactcctt ggacagttta ctttgattgg aattccacca gcccctcgtg gagttcctca gattgaagtt acatttgaca ttgatgccaa tgggatagta catgtttctg ctaaagataa aggcacagga cgtgagcagc agattgtaat ccagtcttct ggtggattaa gcaaagatga tattgaaaat atggttaaaa atgcagagaa atatgctgaa gaagaccggc gaaagaagga acgagttgaa gcagttaata tggctgaagg aatcattcac gacacagaaa ccaagatgga agaattcaag gaccaattac ctgctgatga gtgcaacaag ctgaaagaag agatttccaa aatgagggag ctcctggcta gaaaagacag cgaaacagga gaaaatatta gacaggcagc atcctctctt cagcaggcat cattgaagct gttcgaaatg gcatacaaaa agatggcatc tgagcgagaa ggctctggaa gttctggcac tggggaacaa aaggaagatc aaaaggagga aaaacagtaa. It is sometimes possible for the material contained within the vial of "HSPA9, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
