Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HSPA8 cdna clone

HSPA8 cDNA Clone

Gene Names
HSPA8; LAP1; HSC54; HSC70; HSC71; HSP71; HSP73; LAP-1; NIP71; HEL-33; HSPA10; HEL-S-72p
Synonyms
HSPA8; HSPA8 cDNA Clone; HSPA8 cdna clone
Ordering
For Research Use Only!
Sequence
atgtccaagggacctgcagttggtattgatcttggcaccacctactcttgtgtgggtgttttccagcacggaaaagtcgagataattgccaatgatcagggaaaccgaaccactccaagctatgtcgcctttacggacactgaacggttgatcggtgatgccgcaaagaatcaagttgcaatgaaccccaccaacacagtttttgatgccaaacgtctgattggacgcagatttgatgatgctgttgtccagtctgatatgaaacattggccctttatggtggtgaatgatgctggcaggcccaaggtccaagtagaatacaagggagagaccaaaagcttctatccagaggaggtgtcttctatggttctgacaaagatgaaggaaattgcagaagcctaccttgggaagactgttaccaatgctgtggtcacagtgccagcttactttaatgactctcagcgtcaggctaccaaagatgctggaactattgctggtctcaatgtacttagaattattaatgagccaactgctgctgctattgcttacggcttagacaaaaaggttggagcagaaagaaacgtgctcatctttgacctgggaggtggcacttttgatgtgtcaatcctcactattgaggatggaatctttgaggtcaagtctacagctggagacacccacttgggtggagaagattttgacaaccgaatggtcaaccattttattgctgagtttaagcgcaagcataagaaggacatcagtgagaacaagagagctgtaagacgcctccgtactgcttgtgaacgtgctaagcgtaccctctcttccagcacccaggccagtattgagatcgattctctctatgaaggaatcgacttctatacctccattacccgtgcccgatttgaagaactgaatgctgacctgttccgtggcaccctggacccagtagagaaagcccttcgagatgccaaactagacaagtcacagattcatgatattgtcctggttggtggttctactcgtatccccaagattcagaagcttctccaagacttcttcaatggaaaagaactgaataagagcatcaaccctgatgaagctgttgcttatggtgcagctgtccaggcagccatcttgtctggagacaagtctgagaatgttcaagatttgctgctcttggatgtcactcctctttcccttggtattgaaactgctggtggagtcatgactgtcctcatcaagcgtaataccaccattcctaccaagcagacacagaccttcactacctattctgacaaccagcctggtgtgcttattcaggtttatgaaggcgagcgtgccatgacaaaggataacaacctgcttggcaagtttgaactcacaggcatacctcctgcaccccgaggtgttcctcagattgaagtcacttttgacattgatgccaatggtatactcaatgtctctgctgtggacaagagtacgggaaaagagaacaagattactatcactaatgacaagggccgtttgagcaaggaagacattgaacgtatggtccaggaagctgagaagtacaaagctgaagatgagaagcagagggacaaggtgtcatccaagaattcacttgagtcctatgccttcaacatgaaagcaactgttgaagatgagaaacttcaaggcaagattaacgatgaggacaaacagaagattctggacaagtgtaatgaaattatcaactggcttgataagaatcagactgccgagaaggaagaatttgaacatcaacagaaagagctggagaaagtttgcaaccccatcatcaccaagctgtaccagagtgcaggaggcatgccaggaggaatgcctgggggatttcctggtggtggagctcctccctctggtggtgcttcctcagggcccaccattgaagaggttgattaa
Sequence Length
1941
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
53,518 Da
NCBI Official Full Name
Homo sapiens heat shock 70kDa protein 8, mRNA
NCBI Official Synonym Full Names
heat shock protein family A (Hsp70) member 8
NCBI Official Symbol
HSPA8
NCBI Official Synonym Symbols
LAP1; HSC54; HSC70; HSC71; HSP71; HSP73; LAP-1; NIP71; HEL-33; HSPA10; HEL-S-72p
NCBI Protein Information
heat shock cognate 71 kDa protein
UniProt Protein Name
Heat shock cognate 71 kDa protein
UniProt Gene Name
HSPA8
UniProt Synonym Gene Names
HSC70; HSP73; HSPA10; LAP-1; LPS-associated protein 1
UniProt Entry Name
HSP7C_HUMAN

NCBI Description

This gene encodes a member of the heat shock protein 70 family, which contains both heat-inducible and constitutively expressed members. This protein belongs to the latter group, which are also referred to as heat-shock cognate proteins. It functions as a chaperone, and binds to nascent polypeptides to facilitate correct folding. It also functions as an ATPase in the disassembly of clathrin-coated vesicles during transport of membrane components through the cell. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]

Uniprot Description

HSC70: Acts as a repressor of transcriptional activation. Inhibits the transcriptional coactivator activity of CITED1 on Smad-mediated transcription. Chaperone. Isoform 2 may function as an endogenous inhibitory regulator of HSC70 by competing the co- chaperones. Interacts with HSPH1/HSP105. Interacts with IRAK1BP1. Identified in a mRNP granule complex, at least composed of ACTB, ACTN4, DHX9, ERG, HNRNPA1, HNRNPA2B1, HNRNPAB, HNRNPD, HNRNPL, HNRNPR, HNRNPU, HSPA1, HSPA8, IGF2BP1, ILF2, ILF3, NCBP1, NCL, PABPC1, PABPC4, PABPN1, RPLP0, RPS3, RPS3A, RPS4X, RPS8, RPS9, SYNCRIP, TROVE2, YBX1 and untranslated mRNAs. Interacts with PACRG and TSC2. Interacts with BAG1. Interacts with SV40 VP1. Interacts with DNAJC7. Interacts with HERC5. Interacts with CITED1 (via N-terminus); the interaction suppresses the association of CITED1 to p300/CBP and Smad-mediated transcription transactivation. Constitutively synthesized. Ubiquitous. Belongs to the heat shock protein 70 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Chaperone; Heat shock protein; Nucleolus; RNA-binding

Chromosomal Location of Human Ortholog: 11q24.1

Cellular Component: cell-cell adherens junction; cytosol; extracellular matrix; extracellular space; focal adhesion; intracellular; lysosomal lumen; lysosomal membrane; membrane; nucleoplasm; nucleus; plasma membrane; ribonucleoprotein complex; ubiquitin ligase complex

Molecular Function: ATP binding; ATPase activity; enzyme binding; G-protein-coupled receptor binding; heat shock protein binding; protein binding; ubiquitin protein ligase binding; unfolded protein binding

Biological Process: ATP metabolic process; cellular response to starvation; negative regulation of transcription, DNA-dependent; neurotransmitter secretion; nuclear mRNA splicing, via spliceosome; protein refolding; protein targeting to lysosome; regulation of mRNA stability; regulation of protein complex assembly; regulation of protein stability

Research Articles on HSPA8

Similar Products

Product Notes

The HSPA8 hspa8 (Catalog #AAA1267847) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtccaagg gacctgcagt tggtattgat cttggcacca cctactcttg tgtgggtgtt ttccagcacg gaaaagtcga gataattgcc aatgatcagg gaaaccgaac cactccaagc tatgtcgcct ttacggacac tgaacggttg atcggtgatg ccgcaaagaa tcaagttgca atgaacccca ccaacacagt ttttgatgcc aaacgtctga ttggacgcag atttgatgat gctgttgtcc agtctgatat gaaacattgg ccctttatgg tggtgaatga tgctggcagg cccaaggtcc aagtagaata caagggagag accaaaagct tctatccaga ggaggtgtct tctatggttc tgacaaagat gaaggaaatt gcagaagcct accttgggaa gactgttacc aatgctgtgg tcacagtgcc agcttacttt aatgactctc agcgtcaggc taccaaagat gctggaacta ttgctggtct caatgtactt agaattatta atgagccaac tgctgctgct attgcttacg gcttagacaa aaaggttgga gcagaaagaa acgtgctcat ctttgacctg ggaggtggca cttttgatgt gtcaatcctc actattgagg atggaatctt tgaggtcaag tctacagctg gagacaccca cttgggtgga gaagattttg acaaccgaat ggtcaaccat tttattgctg agtttaagcg caagcataag aaggacatca gtgagaacaa gagagctgta agacgcctcc gtactgcttg tgaacgtgct aagcgtaccc tctcttccag cacccaggcc agtattgaga tcgattctct ctatgaagga atcgacttct atacctccat tacccgtgcc cgatttgaag aactgaatgc tgacctgttc cgtggcaccc tggacccagt agagaaagcc cttcgagatg ccaaactaga caagtcacag attcatgata ttgtcctggt tggtggttct actcgtatcc ccaagattca gaagcttctc caagacttct tcaatggaaa agaactgaat aagagcatca accctgatga agctgttgct tatggtgcag ctgtccaggc agccatcttg tctggagaca agtctgagaa tgttcaagat ttgctgctct tggatgtcac tcctctttcc cttggtattg aaactgctgg tggagtcatg actgtcctca tcaagcgtaa taccaccatt cctaccaagc agacacagac cttcactacc tattctgaca accagcctgg tgtgcttatt caggtttatg aaggcgagcg tgccatgaca aaggataaca acctgcttgg caagtttgaa ctcacaggca tacctcctgc accccgaggt gttcctcaga ttgaagtcac ttttgacatt gatgccaatg gtatactcaa tgtctctgct gtggacaaga gtacgggaaa agagaacaag attactatca ctaatgacaa gggccgtttg agcaaggaag acattgaacg tatggtccag gaagctgaga agtacaaagc tgaagatgag aagcagaggg acaaggtgtc atccaagaat tcacttgagt cctatgcctt caacatgaaa gcaactgttg aagatgagaa acttcaaggc aagattaacg atgaggacaa acagaagatt ctggacaagt gtaatgaaat tatcaactgg cttgataaga atcagactgc cgagaaggaa gaatttgaac atcaacagaa agagctggag aaagtttgca accccatcat caccaagctg taccagagtg caggaggcat gccaggagga atgcctgggg gatttcctgg tggtggagct cctccctctg gtggtgcttc ctcagggccc accattgaag aggttgatta a. It is sometimes possible for the material contained within the vial of "HSPA8, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.