Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HSD3B7 cdna clone

HSD3B7 cDNA Clone

Synonyms
HSD3B7; HSD3B7 cDNA Clone; HSD3B7 cdna clone
Ordering
For Research Use Only!
Sequence
atggccgactctgcacaggcccagaagctggtgtacctggtcacagggggctgtggcttcctgggagagcacgtggtgcgaatgctgctgcagcgggagccccggctcggggagctgcgggtctttgaccaacacctgggtccctggctggaggagctgaagacagggcctgtgagggtgactgccatccagggggacgtgacccaggcccatgaggtggcagcagctgtggccggagcccatgtggtcatccacacggctgggctggtagacgtgtttggcagggccagtcccaagaccatccatgaggtcaacgtgcagggtacccggaacgtgatcgaggcttgtgtgcagaccggaacacggttcctggtctacaccagcagcatggaagttgtggggcctaacaccaaaggtcaccccttctacaggggcaacgaagacaccccatacgaagcagtgcacaggcacccctatccttgcagcaaggccctggccgagtggctggtcctggaggccaacgggaggaaggtccgtggggggctgcccctggtgacgtgtgcccttcgtcccacgggcatctacggtgaaggccaccagatcatgagggacttctaccgccagggcctgcgcctgggaggttggctcttccgggccatcccggcctctgtggagcatggccgggtctatgtgggcaatgttgcctggatgcacgtgctggcagcccgggagctggagcagcgggcaaccctgatgggcggccaggtatacttctgctacgatggatcaccctacaggagctatgaggatttcaacatggagttcctgggcccctgcggactgcggctggtgggcgcccgcccattgctgccctactggctgctggtgttcctggctgccctcaatgccctgctgcagtggctgctgcggccactggtgctctacgcacccctgctgaacccctacacgctggccgtggccaacaccaccttcaccgtcagcaccgacaaggctcagcgccatttcggctatgagcccctgttctcgtgggaggatagccggacccgtaccattctctgggtacaggccgctacgggttcagcccagtga
Sequence Length
1110
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
21,322 Da
NCBI Official Full Name
Homo sapiens hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7, mRNA
UniProt Protein Name
3 beta-hydroxysteroid dehydrogenase type 7
UniProt Gene Name
HSD3B7
UniProt Synonym Gene Names
3-beta-HSD VII; C(27) 3-beta-HSD
UniProt Entry Name
3BHS7_HUMAN

Uniprot Description

HSD3B7: The 3-beta-HSD enzymatic system plays a crucial role in the biosynthesis of all classes of hormonal steroids. HSD VII is active against four 7-alpha-hydroxylated sterols. Does not metabolize several different C(19/21) steroids as substrates. Involved in bile acid synthesis. Defects in HSD3B7 are the cause of congenital bile acid synthesis defect type 1 (CBAS1); also known as neonatal progressive intrahepatic cholestasis. CBAS1 is due to a primary defect in bile synthesis leading to progressive liver disease. Clinical features include neonatal jaundice, severe intrahepatic cholestasis and cirrhosis. Belongs to the 3-beta-HSD family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Lipid Metabolism - primary bile acid biosynthesis; Membrane protein, integral; Membrane protein, multi-pass; EC 1.1.1.181; Oxidoreductase

Chromosomal Location of Human Ortholog: 16p11.2

Cellular Component: endoplasmic reticulum membrane

Molecular Function: 3-beta-hydroxy-delta5-steroid dehydrogenase activity; cholest-5-ene-3-beta,7-alpha-diol 3-beta-dehydrogenase activity; protein binding

Biological Process: bile acid biosynthetic process

Disease: Bile Acid Synthesis Defect, Congenital, 1

Similar Products

Product Notes

The HSD3B7 hsd3b7 (Catalog #AAA1274765) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccgact ctgcacaggc ccagaagctg gtgtacctgg tcacaggggg ctgtggcttc ctgggagagc acgtggtgcg aatgctgctg cagcgggagc cccggctcgg ggagctgcgg gtctttgacc aacacctggg tccctggctg gaggagctga agacagggcc tgtgagggtg actgccatcc agggggacgt gacccaggcc catgaggtgg cagcagctgt ggccggagcc catgtggtca tccacacggc tgggctggta gacgtgtttg gcagggccag tcccaagacc atccatgagg tcaacgtgca gggtacccgg aacgtgatcg aggcttgtgt gcagaccgga acacggttcc tggtctacac cagcagcatg gaagttgtgg ggcctaacac caaaggtcac cccttctaca ggggcaacga agacacccca tacgaagcag tgcacaggca cccctatcct tgcagcaagg ccctggccga gtggctggtc ctggaggcca acgggaggaa ggtccgtggg gggctgcccc tggtgacgtg tgcccttcgt cccacgggca tctacggtga aggccaccag atcatgaggg acttctaccg ccagggcctg cgcctgggag gttggctctt ccgggccatc ccggcctctg tggagcatgg ccgggtctat gtgggcaatg ttgcctggat gcacgtgctg gcagcccggg agctggagca gcgggcaacc ctgatgggcg gccaggtata cttctgctac gatggatcac cctacaggag ctatgaggat ttcaacatgg agttcctggg cccctgcgga ctgcggctgg tgggcgcccg cccattgctg ccctactggc tgctggtgtt cctggctgcc ctcaatgccc tgctgcagtg gctgctgcgg ccactggtgc tctacgcacc cctgctgaac ccctacacgc tggccgtggc caacaccacc ttcaccgtca gcaccgacaa ggctcagcgc catttcggct atgagcccct gttctcgtgg gaggatagcc ggacccgtac cattctctgg gtacaggccg ctacgggttc agcccagtga. It is sometimes possible for the material contained within the vial of "HSD3B7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.