Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HSD3B2 cdna clone

HSD3B2 cDNA Clone

Gene Names
HSD3B2; HSDB; HSD3B; SDR11E2
Synonyms
HSD3B2; HSD3B2 cDNA Clone; HSD3B2 cdna clone
Ordering
For Research Use Only!
Sequence
atgggctggagctgccttgtgacaggagcaggagggcttctgggtcagaggatcgtccgcctgttggtggaagagaaggaactgaaggagatcagggccttggacaaggccttcagaccagaattgagagaggaattttctaagctccagaacaggaccaagctgactgtacttgaaggagacattctggatgagccattcctgaaaagagcctgccaggacgtctcggtcgtcatccacaccgcctgtatcattgatgtctttggtgtcactcacagagagtccatcatgaatgtcaatgtgaaaggtacccagctactgttggaggcctgtgtccaagccagtgtgccagtcttcatctacaccagtagcatagaggtagccgggcccaactcctacaaggaaatcatccagaacggccacgaagaagagcctctggaaaacacatggcccactccatacccgtacagcaaaaagcttgctgagaaggctgtgctggcggctaatgggtggaatctaaaaaatggtgataccttgtacacttgtgcgttaagacccacatatatctatggggaaggaggcccattcctttctgccagtataaatgaggccctgaacaacaatgggatcctgtcaagtgttggaaagttctctacagtcaacccagtctatgttggcaacgtggcctgggcccacattctggccttgagggctctgcgggaccccaagaaggccccaagtgtccgaggtcaattctattacatctcagatgacacgcctcaccaaagctatgataaccttaattacatcctgagcaaagagtttggcctccgccttgattccagatggagccttcctttaaccctgatgtactggattggcttcctgctggaagtagtgagcttcctactcagcccaatttactcctatcaaccccccttcaaccgccacacagtcacattatcaaatagtgtgttcaccttctcttacaagaaggctcagcgagatctggcgtataagccactctacagctgggaggaagccaagcagaaaaccgtggagtgggttggttcccttgtggaccggcacaaggagaccctgaagtccaagactcagtga
Sequence Length
1119
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
24,987 Da
NCBI Official Full Name
Homo sapiens hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 2, mRNA
NCBI Official Synonym Full Names
hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 2
NCBI Official Symbol
HSD3B2
NCBI Official Synonym Symbols
HSDB; HSD3B; SDR11E2
NCBI Protein Information
3 beta-hydroxysteroid dehydrogenase/Delta 5-->4-isomerase type 2
UniProt Protein Name
3 beta-hydroxysteroid dehydrogenase/Delta 5-->4-isomerase type 2
UniProt Gene Name
HSD3B2
UniProt Synonym Gene Names
HSDB3B; 3-beta-HSD II
UniProt Entry Name
3BHS2_HUMAN

NCBI Description

The protein encoded by this gene is a bifunctional enzyme that catalyzes the oxidative conversion of delta(5)-ene-3-beta-hydroxy steroid, and the oxidative conversion of ketosteroids. It plays a crucial role in the biosynthesis of all classes of hormonal steroids. This gene is predominantly expressed in the adrenals and the gonads. Mutations in this gene are associated with 3-beta-hydroxysteroid dehydrogenase, type II, deficiency. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Oct 2009]

Uniprot Description

HSD3B2: protein localized to the nucleus in proliferating cells that seems to possess a tumor suppressor activity. Directly interacts with the RNA helicase eIF4A and inhibits protein synthesis by interfering with the assembly of the cap-dependent translation initiation complex. Suppresses carbonic anhydrase type II protein expression in carcinoid cell lines. Since tumor cells require a high bicarbonate flux for their growth, carbonic anhydrase suppression results in growth inhibition. Expression of this gene is modulated by cytokines in natural killer and T cells. The gene product is thought to play a role in apoptosis but the specific role has not yet been determined. Two differentially spliced isoforms have been identified.

Protein type: Isomerase; Membrane protein, integral; Oxidoreductase; EC 5.3.3.1; Endoplasmic reticulum; EC 1.1.1.145; Lipid Metabolism - androgen and estrogen; Lipid Metabolism - C21-steroid hormone; Mitochondrial

Chromosomal Location of Human Ortholog: 1p13.1

Cellular Component: endoplasmic reticulum membrane; mitochondrial inner membrane; mitochondrial intermembrane space; smooth endoplasmic reticulum membrane

Molecular Function: 3-beta-hydroxy-delta5-steroid dehydrogenase activity; steroid delta-isomerase activity

Biological Process: androgen biosynthetic process; glucocorticoid biosynthetic process; mineralocorticoid biosynthetic process; steroid biosynthetic process

Disease: 3-beta-hydroxysteroid Dehydrogenase, Type Ii, Deficiency Of

Research Articles on HSD3B2

Similar Products

Product Notes

The HSD3B2 hsd3b2 (Catalog #AAA1274115) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggctgga gctgccttgt gacaggagca ggagggcttc tgggtcagag gatcgtccgc ctgttggtgg aagagaagga actgaaggag atcagggcct tggacaaggc cttcagacca gaattgagag aggaattttc taagctccag aacaggacca agctgactgt acttgaagga gacattctgg atgagccatt cctgaaaaga gcctgccagg acgtctcggt cgtcatccac accgcctgta tcattgatgt ctttggtgtc actcacagag agtccatcat gaatgtcaat gtgaaaggta cccagctact gttggaggcc tgtgtccaag ccagtgtgcc agtcttcatc tacaccagta gcatagaggt agccgggccc aactcctaca aggaaatcat ccagaacggc cacgaagaag agcctctgga aaacacatgg cccactccat acccgtacag caaaaagctt gctgagaagg ctgtgctggc ggctaatggg tggaatctaa aaaatggtga taccttgtac acttgtgcgt taagacccac atatatctat ggggaaggag gcccattcct ttctgccagt ataaatgagg ccctgaacaa caatgggatc ctgtcaagtg ttggaaagtt ctctacagtc aacccagtct atgttggcaa cgtggcctgg gcccacattc tggccttgag ggctctgcgg gaccccaaga aggccccaag tgtccgaggt caattctatt acatctcaga tgacacgcct caccaaagct atgataacct taattacatc ctgagcaaag agtttggcct ccgccttgat tccagatgga gccttccttt aaccctgatg tactggattg gcttcctgct ggaagtagtg agcttcctac tcagcccaat ttactcctat caacccccct tcaaccgcca cacagtcaca ttatcaaata gtgtgttcac cttctcttac aagaaggctc agcgagatct ggcgtataag ccactctaca gctgggagga agccaagcag aaaaccgtgg agtgggttgg ttcccttgtg gaccggcaca aggagaccct gaagtccaag actcagtga. It is sometimes possible for the material contained within the vial of "HSD3B2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.