Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HSD17B7 cdna clone

HSD17B7 cDNA Clone

Gene Names
HSD17B7; PRAP; SDR37C1
Synonyms
HSD17B7; HSD17B7 cDNA Clone; HSD17B7 cdna clone
Ordering
For Research Use Only!
Sequence
atgcgaaaggtggttttgatcaccggggctagcagtggcattggcctggccctctgcaagcggctgctggcggaagatgatgagcttcatctgtgtttggcgtgcaggaacatgagcaaggcagaagctgtctgtgctgctctgctggcctctcaccccactgctgaggtcaccattgtccaggtggatgtcagcaacctgcagtcggtcttccgggcctccaaggaacttaagcaaaggtttcagagattagactgtatatatctaaatgctgggatcatgcctaatccacaactaaatatcaaagcacttttctttggcctcttttcaagaaaagtgattcatatgttctccacagctgaaggcctgctgacccagggtgataagatcactgctgatggacttcaggaggtgtttgagaccaatgtctttggccattttatcctgattcgggaactggagcctctcctctgtcacagtgacaatccatctcagctcatctggacatcatctcgcagtgcaaggaaatctaatttcagcctcgaggacttccagcacagcaaaggcaaggaaccctacagctcttccaaatatgccactgaccttttgagtgtggctttgaacaggaacttcaaccagcagggtctctattccaatgtggcctgtccaggtacagcattgaccaatttgacatatggaattctgcctccgtttatatggacgctgttgatgccggcaatattgctacttcgcttttttgcaaatgcattcactttgacaccatataatggaacagaagctctggtatggcttttccaccaaaagcctgaatctctcaatcctctgatcaaatatctgagtgccaccactggctttggaagaaattatattatgacccagaagatggacctagatgaagacactgctgaaaaattttatcaaaagttactggaactggaaaagcacattagggtcactattcaaaaaacagataatcaggccaggctcagtggctcatgcctataa
Sequence Length
1026
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
34,476 Da
NCBI Official Full Name
Homo sapiens hydroxysteroid (17-beta) dehydrogenase 7, mRNA
NCBI Official Synonym Full Names
hydroxysteroid 17-beta dehydrogenase 7
NCBI Official Symbol
HSD17B7
NCBI Official Synonym Symbols
PRAP; SDR37C1
NCBI Protein Information
3-keto-steroid reductase
UniProt Protein Name
3-keto-steroid reductase
UniProt Gene Name
HSD17B7
UniProt Synonym Gene Names
SDR37C1; 17-beta-HSD 7
UniProt Entry Name
DHB7_HUMAN

NCBI Description

HSD17B7 encodes an enzyme that functions both as a 17-beta-hydroxysteroid dehydrogenase (EC 1.1.1.62) in the biosynthesis of sex steroids and as a 3-ketosteroid reductase (EC 1.1.1.270) in the biosynthesis of cholesterol (Marijanovic et al., 2003 [PubMed 12829805]).[supplied by OMIM, May 2010]

Uniprot Description

HSD17B7: Responsible for the reduction of the keto group on the C-3 of sterols. Belongs to the short-chain dehydrogenases/reductases (SDR) family. ERG27 subfamily. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 1.1.1.270; Lipid Metabolism - androgen and estrogen; Oxidoreductase; Endoplasmic reticulum; Membrane protein, integral; EC 1.1.1.62; Lipid Metabolism - steroid biosynthesis

Chromosomal Location of Human Ortholog: 1q23

Cellular Component: endoplasmic reticulum membrane

Molecular Function: 3-keto sterol reductase activity

Biological Process: cholesterol biosynthetic process

Research Articles on HSD17B7

Similar Products

Product Notes

The HSD17B7 hsd17b7 (Catalog #AAA1272605) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcgaaagg tggttttgat caccggggct agcagtggca ttggcctggc cctctgcaag cggctgctgg cggaagatga tgagcttcat ctgtgtttgg cgtgcaggaa catgagcaag gcagaagctg tctgtgctgc tctgctggcc tctcacccca ctgctgaggt caccattgtc caggtggatg tcagcaacct gcagtcggtc ttccgggcct ccaaggaact taagcaaagg tttcagagat tagactgtat atatctaaat gctgggatca tgcctaatcc acaactaaat atcaaagcac ttttctttgg cctcttttca agaaaagtga ttcatatgtt ctccacagct gaaggcctgc tgacccaggg tgataagatc actgctgatg gacttcagga ggtgtttgag accaatgtct ttggccattt tatcctgatt cgggaactgg agcctctcct ctgtcacagt gacaatccat ctcagctcat ctggacatca tctcgcagtg caaggaaatc taatttcagc ctcgaggact tccagcacag caaaggcaag gaaccctaca gctcttccaa atatgccact gaccttttga gtgtggcttt gaacaggaac ttcaaccagc agggtctcta ttccaatgtg gcctgtccag gtacagcatt gaccaatttg acatatggaa ttctgcctcc gtttatatgg acgctgttga tgccggcaat attgctactt cgcttttttg caaatgcatt cactttgaca ccatataatg gaacagaagc tctggtatgg cttttccacc aaaagcctga atctctcaat cctctgatca aatatctgag tgccaccact ggctttggaa gaaattatat tatgacccag aagatggacc tagatgaaga cactgctgaa aaattttatc aaaagttact ggaactggaa aagcacatta gggtcactat tcaaaaaaca gataatcagg ccaggctcag tggctcatgc ctataa. It is sometimes possible for the material contained within the vial of "HSD17B7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.