Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HSD17B3 cdna clone

HSD17B3 cDNA Clone

Gene Names
HSD17B3; EDH17B3; SDR12C2
Synonyms
HSD17B3; HSD17B3 cDNA Clone; HSD17B3 cdna clone
Ordering
For Research Use Only!
Sequence
atgggggacgtcctggaacagttcttcatcctcacagggctgctggtgtgcctggcctgcctggcgaagtgcgtgagattctccagatgtgttttactgaactactggaaagttttgccaaagtctttcttgcggtcaatgggacagtgggcagtgatcactggagcaggcgatggaattgggaaagcgtactcgttcgagctagcaaaacgtggactcaatgttgtccttattagccggacgctggaaaaactagaggccattgccacagagatcgagcggactacagggaggagtgtgaagattatacaagcagattttacaaaagatgacatctacgagcatattaaagaaaaacttgcaggcttagaaattggaattttagtcaacaatgtcggaatgcttccaaaccttctcccaagccatttcctgaacgcaccggatgaaatccagagcctcatccattgtaacatcacctccgtagtcaagatgacacagctaattctgaaacatatggaatcaaggcagaaaggtctcatcctgaacatttcttctgggatagccctgtttccttggcctctctactccatgtactcagcttccaaggcgtttgtgtgcgcattttccaaggccctgcaagaggaatataaagcaaaagaagtcatcatccaggtgctgaccccatatgctgtctcgactgcaatgacaaagtatctaaatacaaatgtgataaccaagactgctgatgagtttgtcaaagagtcattgaattatgtcacaattggaggtgaaacctgtggctgccttgcccatgaaatcttggcgggctttctgagcctgatcccggcctgggccttctacagcggtgccttccaaaggctgctcctgacacactatgtggcatacctgaagctcaacaccaaggtcaggtag
Sequence Length
933
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
29,109 Da
NCBI Official Full Name
Homo sapiens hydroxysteroid (17-beta) dehydrogenase 3, mRNA
NCBI Official Synonym Full Names
hydroxysteroid 17-beta dehydrogenase 3
NCBI Official Symbol
HSD17B3
NCBI Official Synonym Symbols
EDH17B3; SDR12C2
NCBI Protein Information
testosterone 17-beta-dehydrogenase 3
UniProt Protein Name
Testosterone 17-beta-dehydrogenase 3
UniProt Gene Name
HSD17B3
UniProt Synonym Gene Names
EDH17B3; SDR12C2; 17-beta-HSD 3
UniProt Entry Name
DHB3_HUMAN

NCBI Description

This isoform of 17 beta-hydroxysteroid dehydrogenase is expressed predominantly in the testis and catalyzes the conversion of androstenedione to testosterone. It preferentially uses NADP as cofactor. Deficiency can result in male pseudohermaphroditism with gynecomastia. [provided by RefSeq, Jul 2008]

Uniprot Description

HSD17B3: Favors the reduction of androstenedione to testosterone. Uses NADPH while the two other EDH17B enzymes use NADH. Defects in HSD17B3 are the cause of male pseudohermaphrodism with gynecomastia (MPH). These individuals have unambiguous female external genitalia at birth, but fail to menstruate at the time of expected puberty and instead virilize as evidenced by growth of the phallus. Breast development may or may not take place. Belongs to the short-chain dehydrogenases/reductases (SDR) family. 17-beta-HSD 3 subfamily.

Protein type: Oxidoreductase; Lipid Metabolism - androgen and estrogen; EC 1.1.1.64

Chromosomal Location of Human Ortholog: 9q22

Cellular Component: endoplasmic reticulum; endoplasmic reticulum membrane; intracellular membrane-bound organelle

Molecular Function: 3-alpha(17-beta)-hydroxysteroid dehydrogenase (NAD+) activity; testosterone 17-beta-dehydrogenase (NADP+) activity

Biological Process: androgen biosynthetic process

Disease: 17-beta Hydroxysteroid Dehydrogenase Iii Deficiency

Research Articles on HSD17B3

Similar Products

Product Notes

The HSD17B3 hsd17b3 (Catalog #AAA1269509) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggggacg tcctggaaca gttcttcatc ctcacagggc tgctggtgtg cctggcctgc ctggcgaagt gcgtgagatt ctccagatgt gttttactga actactggaa agttttgcca aagtctttct tgcggtcaat gggacagtgg gcagtgatca ctggagcagg cgatggaatt gggaaagcgt actcgttcga gctagcaaaa cgtggactca atgttgtcct tattagccgg acgctggaaa aactagaggc cattgccaca gagatcgagc ggactacagg gaggagtgtg aagattatac aagcagattt tacaaaagat gacatctacg agcatattaa agaaaaactt gcaggcttag aaattggaat tttagtcaac aatgtcggaa tgcttccaaa ccttctccca agccatttcc tgaacgcacc ggatgaaatc cagagcctca tccattgtaa catcacctcc gtagtcaaga tgacacagct aattctgaaa catatggaat caaggcagaa aggtctcatc ctgaacattt cttctgggat agccctgttt ccttggcctc tctactccat gtactcagct tccaaggcgt ttgtgtgcgc attttccaag gccctgcaag aggaatataa agcaaaagaa gtcatcatcc aggtgctgac cccatatgct gtctcgactg caatgacaaa gtatctaaat acaaatgtga taaccaagac tgctgatgag tttgtcaaag agtcattgaa ttatgtcaca attggaggtg aaacctgtgg ctgccttgcc catgaaatct tggcgggctt tctgagcctg atcccggcct gggccttcta cagcggtgcc ttccaaaggc tgctcctgac acactatgtg gcatacctga agctcaacac caaggtcagg tag. It is sometimes possible for the material contained within the vial of "HSD17B3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.