Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HOMER1 cdna clone

HOMER1 cDNA Clone

Gene Names
HOMER1; HOMER; SYN47; Ves-1; HOMER1A; HOMER1B; HOMER1C
Synonyms
HOMER1; HOMER1 cDNA Clone; HOMER1 cdna clone
Ordering
For Research Use Only!
Sequence
atgggggaacaacctatcttcagcactcgagctcatgtcttccaaattgacccaaacacaaagaagaactgggtacccaccagcaagcatgcagttactgtgtcttatttctatgacagcacaagaaatgtgtataggataatcagtttagatggctcaaaggcaataataaatagtaccatcaccccaaacatgacatttactaaaacatctcagaagtttggccagtgggctgatagccgggcaaacaccgtttatggattgggattctcctctgagcatcatctttcgaaatttgcagaaaagtttcaggaatttaaagaagctgctcgactagcaaaggaaaaatcacaagagaagatggaacttaccagtacaccttcacaggaatccgcaggcggggatcttcagtctcctttaacaccggaaagtatcaacgggacagatgatgaaagaacacctgatgtgacacagaactcagagccaagggctgaaccaactcagaatgcattgccattttcacatagttcagcaatcagcaaacattgggaggctgaactggctaccctcaaaggaaataatgccaaactcactgcagccctgctggagtccactgccaatgtgaaacaatggaaacagcaacttgctgcctatcaagaggaagcagaacgtctgcacaagcgggtgactgaacttgaatgtgttagtagccaagcaaatgcagtacatactcataagacagaattaaatcagacaatacaagaactggaagagacactgaaactgaaggaagaggaaatagaaaggttaaaacaagaaattgataatgccagagaactacaagaacagagggattctttgactcagaaactacaggaagtagaaattcggaacaaagacctggagggacaactgtctgacttagagcaacgtctggagaaaagtcagaatgaacaagaagcttttcgcaataacctgaagacactcttagaaattctggatggaaagatatttgaactaacagaattacgagataacttggccaagctactagaatgcagctaa
Sequence Length
1065
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
19,861 Da
NCBI Official Full Name
Homo sapiens homer homolog 1 (Drosophila), mRNA
NCBI Official Synonym Full Names
homer scaffolding protein 1
NCBI Official Symbol
HOMER1
NCBI Official Synonym Symbols
HOMER; SYN47; Ves-1; HOMER1A; HOMER1B; HOMER1C
NCBI Protein Information
homer protein homolog 1
UniProt Protein Name
Homer protein homolog 1
Protein Family
UniProt Gene Name
HOMER1
UniProt Synonym Gene Names
SYN47; Homer-1
UniProt Entry Name
HOME1_HUMAN

NCBI Description

This gene encodes a member of the homer family of dendritic proteins. Members of this family regulate group 1 metabotrophic glutamate receptor function. [provided by RefSeq, Jul 2008]

Uniprot Description

HOMER1: Postsynaptic density scaffolding protein. Binds and cross-links cytoplasmic regions of GRM1, GRM5, ITPR1, DNM3, RYR1, RYR2, SHANK1 and SHANK3. By physically linking GRM1 and GRM5 with ER-associated ITPR1 receptors, it aids the coupling of surface receptors to intracellular calcium release. May also couple GRM1 to PI3 kinase through its interaction with AGAP2. Isoform 1 regulates the trafficking and surface expression of GRM5. Isoform 3 acts as a natural dominant negative, in dynamic competition with constitutively expressed isoform 1 to regulate synaptic metabotropic glutamate function. Isoform 3, may be involved in the structural changes that occur at synapses during long-lasting neuronal plasticity and development. Interacts with IFT57. Interacts with OPHN1. Isoform 1 encodes a coiled-coil structure that mediates homo- and heteromultimerization. Belongs to the Homer family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Adaptor/scaffold; Cell development/differentiation

Chromosomal Location of Human Ortholog: 5q14.2

Molecular Function: metabotropic glutatmate receptor binding; protein binding

Biological Process: metabotropic glutamate receptor, phospholipase C activating pathway; positive regulation of signal transduction; response to calcium ion; synaptic transmission

Research Articles on HOMER1

Similar Products

Product Notes

The HOMER1 homer1 (Catalog #AAA1275015) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggggaac aacctatctt cagcactcga gctcatgtct tccaaattga cccaaacaca aagaagaact gggtacccac cagcaagcat gcagttactg tgtcttattt ctatgacagc acaagaaatg tgtataggat aatcagttta gatggctcaa aggcaataat aaatagtacc atcaccccaa acatgacatt tactaaaaca tctcagaagt ttggccagtg ggctgatagc cgggcaaaca ccgtttatgg attgggattc tcctctgagc atcatctttc gaaatttgca gaaaagtttc aggaatttaa agaagctgct cgactagcaa aggaaaaatc acaagagaag atggaactta ccagtacacc ttcacaggaa tccgcaggcg gggatcttca gtctccttta acaccggaaa gtatcaacgg gacagatgat gaaagaacac ctgatgtgac acagaactca gagccaaggg ctgaaccaac tcagaatgca ttgccatttt cacatagttc agcaatcagc aaacattggg aggctgaact ggctaccctc aaaggaaata atgccaaact cactgcagcc ctgctggagt ccactgccaa tgtgaaacaa tggaaacagc aacttgctgc ctatcaagag gaagcagaac gtctgcacaa gcgggtgact gaacttgaat gtgttagtag ccaagcaaat gcagtacata ctcataagac agaattaaat cagacaatac aagaactgga agagacactg aaactgaagg aagaggaaat agaaaggtta aaacaagaaa ttgataatgc cagagaacta caagaacaga gggattcttt gactcagaaa ctacaggaag tagaaattcg gaacaaagac ctggagggac aactgtctga cttagagcaa cgtctggaga aaagtcagaa tgaacaagaa gcttttcgca ataacctgaa gacactctta gaaattctgg atggaaagat atttgaacta acagaattac gagataactt ggccaagcta ctagaatgca gctaa. It is sometimes possible for the material contained within the vial of "HOMER1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.