Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HNRPLL cdna clone

HNRPLL cDNA Clone

Gene Names
HNRNPLL; SRRF; HNRPLL
Synonyms
HNRPLL; HNRPLL cDNA Clone; HNRPLL cdna clone
Ordering
For Research Use Only!
Sequence
atgttggctcgggagacgtacgaggaggaccgggagtacgagagccaggccaagcgtctcaagaccgaggagggggagatcgactactcggccgaggaaggcgagaaccgccgggaagcgacgccccggggcgggggcgatggcggcggcggcggccggagcttctctcagccggaggcaggtggaagtcatcataaagtttctgtttcacccgtcgtccatgttcgaggactctgtgaatctgtggtggaagcagacctcgtggaagcgctggaaaaatttgggacaatatgctatgtgatgatgatgccatttaaacgacaggctctagtggaatttgaaaacatagatagtgccaaagaatgtgtgacatttgctgcagatgaacccgtgtacattgctggtcaacaggcttttttcaactattctacaagcaaaaggatcactcggccaggaaatactgatgatccatcaggaggcaacaaagttcttctgctctcaattcagaatccgctttatccaattacagtggatgttttatatactgtatgcaaccctgttggcaaagtgcaacgtattgttatattcaagagaaatgggatacaagcaatggttgagtttgaatcagtcctttgtgcccagaaagctaaagcagcactcaatggagctgatatatatgctggatgttgcacactaaaaattgaatatgcacggccaactcgtctaaatgttattaggaatgacaatgacagttgggactacactaaaccatatttgggaagacgaggtaggtattttatacattttagaatgtacttgatctgctga
Sequence Length
828
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
56,467 Da
NCBI Official Full Name
Homo sapiens heterogeneous nuclear ribonucleoprotein L-like, mRNA
NCBI Official Synonym Full Names
heterogeneous nuclear ribonucleoprotein L like
NCBI Official Symbol
HNRNPLL
NCBI Official Synonym Symbols
SRRF; HNRPLL
NCBI Protein Information
heterogeneous nuclear ribonucleoprotein L-like
UniProt Protein Name
Heterogeneous nuclear ribonucleoprotein L-like
UniProt Gene Name
HNRNPLL
UniProt Synonym Gene Names
HNRPLL; SRRF; hnRNPLL
UniProt Entry Name
HNRLL_HUMAN

NCBI Description

HNRNPLL is a master regulator of activation-induced alternative splicing in T cells. In particular, it alters splicing of CD45 (PTPRC; MIM 151460), a tyrosine phosphatase essential for T-cell development and activation (Oberdoerffer et al., 2008 [PubMed 18669861]).[supplied by OMIM, Aug 2008]

Uniprot Description

HNRPLL: RNA-binding protein that functions as regulator of alternative splicing for multiple target mRNAs, including PTPRC/CD45 and STAT5A. Required for alternative splicing of PTPRC. Interacts with HNRNPL. Up-regulated in stimulated T-cells. Widely expressed. Detected in bone marrow stroma cells, skeletal muscle, heart, placenta, pancreas, kidney and lung. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: RNA-binding

Chromosomal Location of Human Ortholog: 2p22.1

Cellular Component: membrane

Molecular Function: mRNA binding; protein binding

Biological Process: positive regulation of RNA splicing

Research Articles on HNRPLL

Similar Products

Product Notes

The HNRPLL hnrnpll (Catalog #AAA1266431) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttggctc gggagacgta cgaggaggac cgggagtacg agagccaggc caagcgtctc aagaccgagg agggggagat cgactactcg gccgaggaag gcgagaaccg ccgggaagcg acgccccggg gcgggggcga tggcggcggc ggcggccgga gcttctctca gccggaggca ggtggaagtc atcataaagt ttctgtttca cccgtcgtcc atgttcgagg actctgtgaa tctgtggtgg aagcagacct cgtggaagcg ctggaaaaat ttgggacaat atgctatgtg atgatgatgc catttaaacg acaggctcta gtggaatttg aaaacataga tagtgccaaa gaatgtgtga catttgctgc agatgaaccc gtgtacattg ctggtcaaca ggcttttttc aactattcta caagcaaaag gatcactcgg ccaggaaata ctgatgatcc atcaggaggc aacaaagttc ttctgctctc aattcagaat ccgctttatc caattacagt ggatgtttta tatactgtat gcaaccctgt tggcaaagtg caacgtattg ttatattcaa gagaaatggg atacaagcaa tggttgagtt tgaatcagtc ctttgtgccc agaaagctaa agcagcactc aatggagctg atatatatgc tggatgttgc acactaaaaa ttgaatatgc acggccaact cgtctaaatg ttattaggaa tgacaatgac agttgggact acactaaacc atatttggga agacgaggta ggtattttat acattttaga atgtacttga tctgctga. It is sometimes possible for the material contained within the vial of "HNRPLL, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.