Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HNRNPR cdna clone

HNRNPR cDNA Clone

Gene Names
HNRNPR; HNRPR; hnRNP-R
Synonyms
HNRNPR; HNRNPR cDNA Clone; HNRNPR cdna clone
Ordering
For Research Use Only!
Sequence
atggctaatcaggtgaatggtaatgcggtacagttaaaagaagaggaagaaccaatggatacttccagtgtaactcacacagaacactacaagacactgatagaggcaggcctcccacagaaggtggcagaaagacttgatgaaatatttcagacaggattggtagcttatgtcgatcttgatgaaagagcaattgatgctctcagggaatttaatgaagaaggagctctgtctgtactacagcagttcaaggaaagtgacttatcacatgttcagaacaaaagtgcatttttatgtggagttatgaagacctacaggcagagagagaaacaggggagcaaggtgcaagagtccacaaagggacctgatgaagcgaagatcaaggccttgcttgagagaactggttatactctggatgtaaccacaggacagaggaagtatggtggtcctccaccagacagtgtgtactctggcgtgcaacctggaattggaacggaggtatttgtaggcaaaataccaagggatttatatgaggatgagttggtgcccctttttgagaaggccggacccatttgggatctacgtcttatgatggatccactgtccggtcagaatagagggtatgcatttatcaccttctgtggaaaggaagctgcacaggaagccgtgaaactgtgtgacagctatgaaattcgccctggtaaacaccttggagtgtgcatttctgtggcaaacaacagactttttgttggatccattccgaagaataagactaaagaaaacattttggaagaattcagtaaagtcacaggtttaacagagggtttggtggacgttattctctatcatcaacccgatgacaaaaagaagaatcgggggttctgcttccttgaatatgaggatcacaagtcagcagcacaagccagacgccggctgatgagtggaaaagtaaaagtgtggggaaatgtagttacagttgaatgggctgaccctgtggaagaaccagatccagaagtcatggctaaggtaaaagttttgtttgtgagaaacttggctactacggtgacagaagaaatattggaaaagtcattttctgaatttggaaaactcgaaagagtaaagaagttgaaagattatgcatttgttcattttgaagacagaggagcagctgttaaggctatggatgaaatgaatggcaaagaaatagaaggggaagaaattgaaatagtcttagccaagccaccagacaagaaaaggaaagagcgccaagctgctagacaggcctccagaagcactgcgtatgaagattattactaccaccctcctcctcgcatgccacctccaattagaggtcggggtcgtggtggggggagaggtggatatggctaccctccagattactacggctatgaagattactatgatgattactatggttatgattatcacgactatcgtggaggctatgaagatccctactacggctatgatgatggctatgcagtaagaggaagaggaggaggaaggggagggcgaggtgctccaccaccaccaagggggaggggagcaccacctccaagaggtagagctggctattcacagaggggggcacctttgggaccaccaagaggctctaggggtggcagagggggtcctgctcaacagcagagaggccgtggttcccgtggatctcggggcaatcgtgggggcaatgtaggaggcaagagaaaggcagatgggtacaaccagcctgattccaagcgtcgtcagaccaacaaccaacagaactggggttcccaacccatcgctcagcagccgcttcagcaaggtggtgactattctggtaactatggttacaataatgacaaccaggaattttatcaggatacttatgggcaacagtggaagtag
Sequence Length
1911
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
59,953 Da
NCBI Official Full Name
Homo sapiens heterogeneous nuclear ribonucleoprotein R, mRNA
NCBI Official Synonym Full Names
heterogeneous nuclear ribonucleoprotein R
NCBI Official Symbol
HNRNPR
NCBI Official Synonym Symbols
HNRPR; hnRNP-R
NCBI Protein Information
heterogeneous nuclear ribonucleoprotein R
UniProt Protein Name
Heterogeneous nuclear ribonucleoprotein R
UniProt Gene Name
HNRNPR
UniProt Synonym Gene Names
HNRPR; hnRNP R
UniProt Entry Name
HNRPR_HUMAN

NCBI Description

This gene encodes an RNA-binding protein that is a member of the spliceosome C complex, which functions in pre-mRNA processing and transport. The encoded protein also promotes transcription at the c-fos gene. Alternative splicing results in multiple transcript variants. There are pseudogenes for this gene on chromosomes 4, 11, and 10. [provided by RefSeq, Jul 2014]

Uniprot Description

hnRNP R: Component of ribonucleosomes, which are complexes of at least 20 other different heterogenious nuclear ribonucleoproteins (hnRNP). hnRNP play an important role in processing of precursor mRNA in the nucleus. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: RNA splicing; Spliceosome; RNA-binding

Chromosomal Location of Human Ortholog: 1p36.12

Cellular Component: nucleolus; nucleoplasm; ribonucleoprotein complex

Molecular Function: protein binding

Biological Process: gene expression; nuclear mRNA splicing, via spliceosome

Research Articles on HNRNPR

Similar Products

Product Notes

The HNRNPR hnrnpr (Catalog #AAA1275306) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctaatc aggtgaatgg taatgcggta cagttaaaag aagaggaaga accaatggat acttccagtg taactcacac agaacactac aagacactga tagaggcagg cctcccacag aaggtggcag aaagacttga tgaaatattt cagacaggat tggtagctta tgtcgatctt gatgaaagag caattgatgc tctcagggaa tttaatgaag aaggagctct gtctgtacta cagcagttca aggaaagtga cttatcacat gttcagaaca aaagtgcatt tttatgtgga gttatgaaga cctacaggca gagagagaaa caggggagca aggtgcaaga gtccacaaag ggacctgatg aagcgaagat caaggccttg cttgagagaa ctggttatac tctggatgta accacaggac agaggaagta tggtggtcct ccaccagaca gtgtgtactc tggcgtgcaa cctggaattg gaacggaggt atttgtaggc aaaataccaa gggatttata tgaggatgag ttggtgcccc tttttgagaa ggccggaccc atttgggatc tacgtcttat gatggatcca ctgtccggtc agaatagagg gtatgcattt atcaccttct gtggaaagga agctgcacag gaagccgtga aactgtgtga cagctatgaa attcgccctg gtaaacacct tggagtgtgc atttctgtgg caaacaacag actttttgtt ggatccattc cgaagaataa gactaaagaa aacattttgg aagaattcag taaagtcaca ggtttaacag agggtttggt ggacgttatt ctctatcatc aacccgatga caaaaagaag aatcgggggt tctgcttcct tgaatatgag gatcacaagt cagcagcaca agccagacgc cggctgatga gtggaaaagt aaaagtgtgg ggaaatgtag ttacagttga atgggctgac cctgtggaag aaccagatcc agaagtcatg gctaaggtaa aagttttgtt tgtgagaaac ttggctacta cggtgacaga agaaatattg gaaaagtcat tttctgaatt tggaaaactc gaaagagtaa agaagttgaa agattatgca tttgttcatt ttgaagacag aggagcagct gttaaggcta tggatgaaat gaatggcaaa gaaatagaag gggaagaaat tgaaatagtc ttagccaagc caccagacaa gaaaaggaaa gagcgccaag ctgctagaca ggcctccaga agcactgcgt atgaagatta ttactaccac cctcctcctc gcatgccacc tccaattaga ggtcggggtc gtggtggggg gagaggtgga tatggctacc ctccagatta ctacggctat gaagattact atgatgatta ctatggttat gattatcacg actatcgtgg aggctatgaa gatccctact acggctatga tgatggctat gcagtaagag gaagaggagg aggaagggga gggcgaggtg ctccaccacc accaaggggg aggggagcac cacctccaag aggtagagct ggctattcac agaggggggc acctttggga ccaccaagag gctctagggg tggcagaggg ggtcctgctc aacagcagag aggccgtggt tcccgtggat ctcggggcaa tcgtgggggc aatgtaggag gcaagagaaa ggcagatggg tacaaccagc ctgattccaa gcgtcgtcag accaacaacc aacagaactg gggttcccaa cccatcgctc agcagccgct tcagcaaggt ggtgactatt ctggtaacta tggttacaat aatgacaacc aggaatttta tcaggatact tatgggcaac agtggaagta g. It is sometimes possible for the material contained within the vial of "HNRNPR, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.