Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HNRNPF cdna clone

HNRNPF cDNA Clone

Gene Names
HNRNPF; HNRPF; mcs94-1; OK/SW-cl.23
Synonyms
HNRNPF; HNRNPF cDNA Clone; HNRNPF cdna clone
Ordering
For Research Use Only!
Sequence
atgatgctgggccctgagggaggtgaaggctttgtggtcaagctccgtggcctgccctggtcctgctctgttgaggacgtgcagaacttcctctctgactgcacgattcatgatggggccgcaggtgtccatttcatctacactagagagggcaggcagagtggtgaggcttttgttgaacttggatcagaagatgatgtaaaaatggccctgaaaaaagacagggaaagcatgggacaccggtacattgaggtgttcaggtcccacagaaccgagatggattgggtgttgaagcacagtggtcccaacagtgccgacagcgccaacgatggcttcgtgcggcttcgaggactcccatttggatgcacaaaggaagaaattgttcagttcttctcagggttggaaattgtgccaaacgggatcacattgcctgtggaccccgaaggcaagattacaggggaagcgttcgtgcagtttgcctcgcaggagttagctgagaaggctctagggaaacacaaggagaggatagggcacaggtacattgaggtgtttaagagcagccaggaggaagttaggtcatactcagatccccctctgaagttcatgtccgtgcagcggccagggccctatgaccggcccgggactgccaggaggtacattggcatcgtgaagcaggcaggcctggaaaggatgaggcctggtgcctacagcacaggctacgggggctacgaggagtacagtggcctcagtgatggctacggcttcaccaccgacctgttcgggagagacctcagctactgtctctccggaatgtatgaccacagatacggcgacagtgagttcacagtgcagagcaccacaggccactgtgtccacatgaggggcctgccgtacaaagcgaccgagaacgacatttacaacttcttctctcctctcaaccctgtgagagtccatattgagattggcccagatggaagagtgacgggtgaagcagatgttgagtttgctactcatgaagaagctgtggcagctatgtccaaagacagggccaatatgcagcacagatatatagaactcttcttgaattcaacaacaggggccagcaatggggcgtatagcagccaggtgatgcaaggcatgggggtgtctgctgcccaggccacttacagtggcctggagagccagtcagtgagtggctgttacggggccggctacagtgggcagaacagcatgggtggctatgactag
Sequence Length
1248
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
45,672 Da
NCBI Official Full Name
Homo sapiens heterogeneous nuclear ribonucleoprotein F, mRNA
NCBI Official Synonym Full Names
heterogeneous nuclear ribonucleoprotein F
NCBI Official Symbol
HNRNPF
NCBI Official Synonym Symbols
HNRPF; mcs94-1; OK/SW-cl.23
NCBI Protein Information
heterogeneous nuclear ribonucleoprotein F
UniProt Protein Name
Heterogeneous nuclear ribonucleoprotein F
UniProt Gene Name
HNRNPF
UniProt Synonym Gene Names
HNRPF; hnRNP F
UniProt Entry Name
HNRPF_HUMAN

NCBI Description

This gene belongs to the subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins that complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and regulate alternative splicing, polyadenylation, and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene has three repeats of quasi-RRM domains that bind to RNAs which have guanosine-rich sequences. This protein is very similar to the family member hnRPH. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jul 2008]

Uniprot Description

hnRNP F: Component of the heterogeneous nuclear ribonucleoprotein (hnRNP) complexes which provide the substrate for the processing events that pre-mRNAs undergo before becoming functional, translatable mRNAs in the cytoplasm. Plays a role in the regulation of alternative splicing events. Binds G-rich sequences in pre-mRNAs and keeps target RNA in an unfolded state.

Protein type: Spliceosome; RNA-binding; RNA splicing

Chromosomal Location of Human Ortholog: 10q11.21

Cellular Component: cytoplasm; membrane; nucleoplasm; nucleus

Molecular Function: protein binding; RNA binding; single-stranded RNA binding

Biological Process: fibroblast growth factor receptor signaling pathway; gene expression; nuclear mRNA splicing, via spliceosome; regulation of RNA splicing; RNA processing

Research Articles on HNRNPF

Similar Products

Product Notes

The HNRNPF hnrnpf (Catalog #AAA1269760) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatgctgg gccctgaggg aggtgaaggc tttgtggtca agctccgtgg cctgccctgg tcctgctctg ttgaggacgt gcagaacttc ctctctgact gcacgattca tgatggggcc gcaggtgtcc atttcatcta cactagagag ggcaggcaga gtggtgaggc ttttgttgaa cttggatcag aagatgatgt aaaaatggcc ctgaaaaaag acagggaaag catgggacac cggtacattg aggtgttcag gtcccacaga accgagatgg attgggtgtt gaagcacagt ggtcccaaca gtgccgacag cgccaacgat ggcttcgtgc ggcttcgagg actcccattt ggatgcacaa aggaagaaat tgttcagttc ttctcagggt tggaaattgt gccaaacggg atcacattgc ctgtggaccc cgaaggcaag attacagggg aagcgttcgt gcagtttgcc tcgcaggagt tagctgagaa ggctctaggg aaacacaagg agaggatagg gcacaggtac attgaggtgt ttaagagcag ccaggaggaa gttaggtcat actcagatcc ccctctgaag ttcatgtccg tgcagcggcc agggccctat gaccggcccg ggactgccag gaggtacatt ggcatcgtga agcaggcagg cctggaaagg atgaggcctg gtgcctacag cacaggctac gggggctacg aggagtacag tggcctcagt gatggctacg gcttcaccac cgacctgttc gggagagacc tcagctactg tctctccgga atgtatgacc acagatacgg cgacagtgag ttcacagtgc agagcaccac aggccactgt gtccacatga ggggcctgcc gtacaaagcg accgagaacg acatttacaa cttcttctct cctctcaacc ctgtgagagt ccatattgag attggcccag atggaagagt gacgggtgaa gcagatgttg agtttgctac tcatgaagaa gctgtggcag ctatgtccaa agacagggcc aatatgcagc acagatatat agaactcttc ttgaattcaa caacaggggc cagcaatggg gcgtatagca gccaggtgat gcaaggcatg ggggtgtctg ctgcccaggc cacttacagt ggcctggaga gccagtcagt gagtggctgt tacggggccg gctacagtgg gcagaacagc atgggtggct atgactag. It is sometimes possible for the material contained within the vial of "HNRNPF, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.