Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HNRNPA2B1 cdna clone

HNRNPA2B1 cDNA Clone

Gene Names
HNRNPA2B1; RNPA2; HNRPA2; HNRPB1; SNRPB1; HNRNPA2; HNRNPB1; IBMPFD2; HNRPA2B1
Synonyms
HNRNPA2B1; HNRNPA2B1 cDNA Clone; HNRNPA2B1 cdna clone
Ordering
For Research Use Only!
Sequence
atggagagagaaaaggaacagttccgtaagctctttattggtggcttaagctttgaaaccacagaagaaagtttgaggaactactacgaacaatggggaaagcttacagactgtgtggtaatgagggatcctgcaagcaaaagatcaagaggatttggttttgtaactttttcatccatggctgaggttgatgctgccatggctgcaagacctcattcaattgatgggagagtagttgagccaaaacgtgctgtagcaagagaggaatctggaaaaccaggggctcatgtaactgtgaagaagctgtttgttggcggaattaaagaagatactgaggaacatcaccttagagattactttgaggaatatggaaaaattgataccattgagataattactgataggcagtctggaaagaaaagaggctttggctttgttacttttgatgaccatgatcctgtggataaaatcgtattgcagaaataccataccatcaatggtcataatgcagaagtaagaaaggctttgtctagacaagaaatgcaggaggacctggaggtggcaattttggaggtagccccggttatggaggaggaagaggaggatatggtggtggaggacctggatatggcaaccagggtgggggctacggaggtggttatgacaactatggaggaggaaattatggaagtggaaattacaatgattttggaaattataaccagcaaccttctaactacggtccaatga
Sequence Length
750
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
36,006 Da
NCBI Official Full Name
Homo sapiens heterogeneous nuclear ribonucleoprotein A2/B1, mRNA
NCBI Official Synonym Full Names
heterogeneous nuclear ribonucleoprotein A2/B1
NCBI Official Symbol
HNRNPA2B1
NCBI Official Synonym Symbols
RNPA2; HNRPA2; HNRPB1; SNRPB1; HNRNPA2; HNRNPB1; IBMPFD2; HNRPA2B1
NCBI Protein Information
heterogeneous nuclear ribonucleoproteins A2/B1
UniProt Protein Name
Heterogeneous nuclear ribonucleoproteins A2/B1
UniProt Gene Name
HNRNPA2B1
UniProt Synonym Gene Names
HNRPA2B1; hnRNP A2/B1
UniProt Entry Name
ROA2_HUMAN

NCBI Description

This gene belongs to the A/B subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins and they complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene has two repeats of quasi-RRM domains that bind to RNAs. This gene has been described to generate two alternatively spliced transcript variants which encode different isoforms. [provided by RefSeq, Jul 2008]

Uniprot Description

hnRNP A2/B1: Involved with pre-mRNA processing. Forms complexes (ribonucleosomes) with at least 20 other different hnRNP and heterogeneous nuclear RNA in the nucleus. Identified in the spliceosome C complex. Identified in a mRNP granule complex, at least composed of ACTB, ACTN4, DHX9, ERG, HNRNPA1, HNRNPA2B1, HNRNPAB, HNRNPD, HNRNPL, HNRNPR, HNRNPU, HSPA1, HSPA8, IGF2BP1, ILF2, ILF3, NCBP1, NCL, PABPC1, PABPC4, PABPN1, RPLP0, RPS3, RPS3A, RPS4X, RPS8, RPS9, SYNCRIP, TROVE2, YBX1 and untranslated mRNAs. Interacts with IGF2BP1. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: RNA splicing; RNA-binding; Spliceosome

Chromosomal Location of Human Ortholog: 7p15

Cellular Component: cytoplasm; membrane; nucleoplasm; nucleus; ribonucleoprotein complex; spliceosome

Molecular Function: miRNA binding; mRNA 3'-UTR binding; protein binding; RNA binding; single-stranded telomeric DNA binding

Biological Process: gene expression; mRNA export from nucleus; mRNA processing; nuclear mRNA splicing, via spliceosome; primary microRNA processing; RNA transport

Disease: Inclusion Body Myopathy With Early-onset Paget Disease With Or Without Frontotemporal Dementia 2

Research Articles on HNRNPA2B1

Similar Products

Product Notes

The HNRNPA2B1 hnrnpa2b1 (Catalog #AAA1268062) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagagag aaaaggaaca gttccgtaag ctctttattg gtggcttaag ctttgaaacc acagaagaaa gtttgaggaa ctactacgaa caatggggaa agcttacaga ctgtgtggta atgagggatc ctgcaagcaa aagatcaaga ggatttggtt ttgtaacttt ttcatccatg gctgaggttg atgctgccat ggctgcaaga cctcattcaa ttgatgggag agtagttgag ccaaaacgtg ctgtagcaag agaggaatct ggaaaaccag gggctcatgt aactgtgaag aagctgtttg ttggcggaat taaagaagat actgaggaac atcaccttag agattacttt gaggaatatg gaaaaattga taccattgag ataattactg ataggcagtc tggaaagaaa agaggctttg gctttgttac ttttgatgac catgatcctg tggataaaat cgtattgcag aaataccata ccatcaatgg tcataatgca gaagtaagaa aggctttgtc tagacaagaa atgcaggagg acctggaggt ggcaattttg gaggtagccc cggttatgga ggaggaagag gaggatatgg tggtggagga cctggatatg gcaaccaggg tgggggctac ggaggtggtt atgacaacta tggaggagga aattatggaa gtggaaatta caatgatttt ggaaattata accagcaacc ttctaactac ggtccaatga. It is sometimes possible for the material contained within the vial of "HNRNPA2B1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.