Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HMOX1 cdna clone

HMOX1 cDNA Clone

Gene Names
HMOX1; HO-1; HSP32; HMOX1D; bK286B10
Synonyms
HMOX1; HMOX1 cDNA Clone; HMOX1 cdna clone
Ordering
For Research Use Only!
Sequence
atggagcgtccgcaacccgacagcatgccccaggatttgtcagaggccctgaaggaggccaccaaggaggtgcacacccaggcagagaatgctgagttcatgaggaactttcagaagggccaggtgacccgagacggcttcaagctggtgatggcctccctgtaccacatctatgtggccctggaggaggagattgagcgcaacaaggagagcccagtcttcgcccctgtctacttcccagaagagctgcaccgcaaggctgccctggagcaggacctggccttctggtacgggccccgctggcaggaggtcatcccctacacaccagccatgcagcactatgtgaagcggctccacgaggtggggcgcacagagcccgagctgctggtggcccacgcctacacccgctacctgggtgacctgtctgggggccaggtgctcaaaaagattgcccagaaagccctggacctgcccagctctggcgagggcctggccttcttcaccttccccaacattgccagtgccaccaagttcaagcagctctaccgctcccgcatgaactccctggagatgactcccgcagtcaggcagagggtgatagaagaggccaagactgcgttcctgctcaacatccagctctttgaggagttgcaggagctgctgacccatgacaccaaggaccagagcccctcacgggcaccagggcttcgccagcgggccagcaacaaagtgcaagattctgcccccgtggagactcccagagggaagcccccactcaacacccgctcccaggctccgcttctccgatgggtccttacactcagctttctggtggcgacagttgctgtagggctttatgccatgtga
Sequence Length
867
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
32,819 Da
NCBI Official Full Name
Homo sapiens heme oxygenase (decycling) 1, mRNA
NCBI Official Synonym Full Names
heme oxygenase 1
NCBI Official Symbol
HMOX1
NCBI Official Synonym Symbols
HO-1; HSP32; HMOX1D; bK286B10
NCBI Protein Information
heme oxygenase 1
UniProt Protein Name
Heme oxygenase 1
UniProt Gene Name
HMOX1
UniProt Synonym Gene Names
HO; HO1; HO-1
UniProt Entry Name
HMOX1_HUMAN

NCBI Description

Heme oxygenase, an essential enzyme in heme catabolism, cleaves heme to form biliverdin, which is subsequently converted to bilirubin by biliverdin reductase, and carbon monoxide, a putative neurotransmitter. Heme oxygenase activity is induced by its substrate heme and by various nonheme substances. Heme oxygenase occurs as 2 isozymes, an inducible heme oxygenase-1 and a constitutive heme oxygenase-2. HMOX1 and HMOX2 belong to the heme oxygenase family. [provided by RefSeq, Jul 2008]

Uniprot Description

HMOX1: Heme oxygenase cleaves the heme ring at the alpha methene bridge to form biliverdin. Biliverdin is subsequently converted to bilirubin by biliverdin reductase. Under physiological conditions, the activity of heme oxygenase is highest in the spleen, where senescent erythrocytes are sequestrated and destroyed. Heme oxygenase 1 activity is highly inducible by its substrate heme and by various non-heme substances such as heavy metals, bromobenzene, endotoxin, oxidizing agents and UVA. Expressed at higher levels in renal cancer tissue than in normal tissue. Belongs to the heme oxygenase family.

Protein type: Oxidoreductase; Cofactor and Vitamin Metabolism - porphyrin and chlorophyll; EC 1.14.99.3

Chromosomal Location of Human Ortholog: 22q13.1

Cellular Component: endoplasmic reticulum; endoplasmic reticulum membrane; extracellular space; membrane; nucleus; perinuclear region of cytoplasm

Molecular Function: enzyme binding; heme binding; heme oxygenase (decyclizing) activity; protein binding; protein homodimerization activity; signal transducer activity

Biological Process: angiogenesis; cell death; cellular iron ion homeostasis; endothelial cell proliferation; erythrocyte homeostasis; excretion; healing during inflammatory response; heme catabolic process; heme oxidation; iron ion homeostasis; negative regulation of leukocyte migration; negative regulation of smooth muscle cell proliferation; positive regulation of chemokine biosynthetic process; positive regulation of I-kappaB kinase/NF-kappaB cascade; positive regulation of smooth muscle cell proliferation; positive regulation of vasodilation; protein homooligomerization; regulation of angiogenesis; regulation of transcription factor activity; regulation of transcription from RNA polymerase II promoter in response to oxidative stress; response to hydrogen peroxide; response to nicotine; response to oxidative stress; smooth muscle hyperplasia

Disease: Heme Oxygenase 1 Deficiency; Pulmonary Disease, Chronic Obstructive

Research Articles on HMOX1

Similar Products

Product Notes

The HMOX1 hmox1 (Catalog #AAA1274792) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagcgtc cgcaacccga cagcatgccc caggatttgt cagaggccct gaaggaggcc accaaggagg tgcacaccca ggcagagaat gctgagttca tgaggaactt tcagaagggc caggtgaccc gagacggctt caagctggtg atggcctccc tgtaccacat ctatgtggcc ctggaggagg agattgagcg caacaaggag agcccagtct tcgcccctgt ctacttccca gaagagctgc accgcaaggc tgccctggag caggacctgg ccttctggta cgggccccgc tggcaggagg tcatccccta cacaccagcc atgcagcact atgtgaagcg gctccacgag gtggggcgca cagagcccga gctgctggtg gcccacgcct acacccgcta cctgggtgac ctgtctgggg gccaggtgct caaaaagatt gcccagaaag ccctggacct gcccagctct ggcgagggcc tggccttctt caccttcccc aacattgcca gtgccaccaa gttcaagcag ctctaccgct cccgcatgaa ctccctggag atgactcccg cagtcaggca gagggtgata gaagaggcca agactgcgtt cctgctcaac atccagctct ttgaggagtt gcaggagctg ctgacccatg acaccaagga ccagagcccc tcacgggcac cagggcttcg ccagcgggcc agcaacaaag tgcaagattc tgcccccgtg gagactccca gagggaagcc cccactcaac acccgctccc aggctccgct tctccgatgg gtccttacac tcagctttct ggtggcgaca gttgctgtag ggctttatgc catgtga. It is sometimes possible for the material contained within the vial of "HMOX1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.